Search Results
) Detection of mcr genes by PCR DNA isolation of strains was performed using bacterial DNA isolation kit (Canvax Biotech, Spain) for mcr 1-5 screening by molecular method. PCR amplification was performed using the primers and PCR conditions listed in
system (bioMérieux, Marcy-l’Ėtoile, France) and confirmed by a polymerase chain reaction (PCR) targeting a 278-bp fragment of the 23S rRNA gene. Bacterial DNA was isolated by the DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) according to the
P Kaposi-Novak 2004 Effect of formalin, acetone, and RNAlater fixatives on tissue preservation and different size amplicons by real-time PCR from paraffin-embedded tissue
as STEC. The bacterial identification of the isolates was performed by classical biochemical methods using triple sugar iron agar, urease, indole and citrate. The confirmation of E. coli identification was done by PCR as described below. Extraction
distributed by Oxoid. Molecular genetic examinations Screening for antibiotic resistance determinants The strains were screened for the presence of TEM, SHV, CTX-M ESBL, plasmdic AmpC, OXA-1-like genes and aac(6′)-Ib by PCR [ 13–15 ]. The PCR products were
% sensitivity and specificity comparable to those of polymerase chain reaction (PCR) [ 2 ]. Moreover, the use of boronic acid disk test in combination with several antibiotic substrates has been evaluated as sensitive and highly specific for the phenotypic
conducted this study among French pilgrims presenting with the symptoms of a respiratory tract infection during Hajj pilgrimages between 2014 and 2018. Pilgrims were sampled at the onset of symptoms and were investigated using PCR for pathogens which were
TEM , and bla SHV ) [ 7 ] was performed via PCR. The Porin ompK35 and ompK36 genes were detected using the following primers: ompK35 fw: CGCAATATTCTGGCAGTGGT, ompK35rv
, decontamination of materials and strict hand washing. The outbreak had been so stopped. Microbiological identification and antimicrobial susceptibility testing A. baumannii were identified by API 20 NE system (bioMerieux, Marcy l’Etoile, France) and PCR
