Search Results
conducted this study among French pilgrims presenting with the symptoms of a respiratory tract infection during Hajj pilgrimages between 2014 and 2018. Pilgrims were sampled at the onset of symptoms and were investigated using PCR for pathogens which were
TEM , and bla SHV ) [ 7 ] was performed via PCR. The Porin ompK35 and ompK36 genes were detected using the following primers: ompK35 fw: CGCAATATTCTGGCAGTGGT, ompK35rv
, decontamination of materials and strict hand washing. The outbreak had been so stopped. Microbiological identification and antimicrobial susceptibility testing A. baumannii were identified by API 20 NE system (bioMerieux, Marcy l’Etoile, France) and PCR
women with abnormal cervical cytology [ 10 ]. In this study we report on the PCR analysis results of the cervical smear results of 328 females, and 50 males who have presented to a tertiary care university hospital in the port city of İzmir, Türkiye
Walsh, P. S., Metzger, D. A., Higuchi, R.: Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques, 1991, 10 , 506–13. Higuchi R
), dNTP Mix 10 mM (2 μL) and Reaction Buffer 5 × (4 μL). Then, samples were incubated for 10 min at 25 °C, 90 min at 42 °C and 5 min at 75 °C. Quantitative real-time PCR data analysis To determine the relative expression of HIF1-α, PDK-4, MCT-4 and GLUT-1
performed by thermal lysis method using the InstaGene Matrix® kit (Bio-Rad®). The search of the mecA gene and the typing of SCCmec cassettes were performed by polymerase chain reaction (PCR) amplification as previously described [ 7–9 ]. Molecular typing
A hajas sejtes leukémia korszerű diagnosztikája és kezelése
Hairy cell leukemia: diagnosis and treatment
using a sensitive pyrosequencing assay. Am J Clin Pathol. 2012; 138: 153–156. 25 Guerrini F, Paolicchi M, Ghio F, et al. The droplet digital PCR: A
[ 12 , 13 ]. Species identification of methicillin-resistant staphylococci All isolates were confirmed as Staphylococci by PCR using 16S RNA primer[ 14 ]. Methicillin resistance was confirmed by
with Ardabil University of Medical Sciences, previously [ 23 ]. According to ERIC-PCR analysis, the isolates belonged to 24 heterogeneous clusters. More than half (57%) of the isolates were from tracheal specimens, while the remaining were from