Search Results

You are looking at 161 - 170 of 885 items for :

  • Medical and Health Sciences x
  • Refine by Access: All Content x
Clear All
Acta Microbiologica et Immunologica Hungarica
Authors:
Maria Chatzidimitriou
,
Panagiota Chatzivasileiou
,
Georgios Sakellariou
,
MariaAnna Kyriazidi
,
Asimoula Kavvada
,
Dimitris Chatzidimitriou
,
Fani Chatzopoulou
,
Georgios Meletis
,
Maria Mavridou
,
Dimitris Rousis
,
Eleni Katsifa
,
Eleni Vagdatli
,
Stella Mitka
, and
Lialiaris Theodoros

% sensitivity and specificity comparable to those of polymerase chain reaction (PCR) [ 2 ]. Moreover, the use of boronic acid disk test in combination with several antibiotic substrates has been evaluated as sensitive and highly specific for the phenotypic

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors:
Van-Thuan Hoang
,
Thi-Loi Dao
,
Tran Duc Anh Ly
,
Tassadit Drali
,
Saber Yezli
,
Philippe Parola
,
Vincent Pommier de Santi
, and
Philippe Gautret

conducted this study among French pilgrims presenting with the symptoms of a respiratory tract infection during Hajj pilgrimages between 2014 and 2018. Pilgrims were sampled at the onset of symptoms and were investigated using PCR for pathogens which were

Open access

TEM , and bla SHV ) [ 7 ] was performed via PCR. The Porin ompK35 and ompK36 genes were detected using the following primers: ompK35 fw: CGCAATATTCTGGCAGTGGT, ompK35rv

Open access

, decontamination of materials and strict hand washing. The outbreak had been so stopped. Microbiological identification and antimicrobial susceptibility testing A. baumannii were identified by API 20 NE system (bioMerieux, Marcy l’Etoile, France) and PCR

Restricted access

women with abnormal cervical cytology [ 10 ]. In this study we report on the PCR analysis results of the cervical smear results of 328 females, and 50 males who have presented to a tertiary care university hospital in the port city of İzmir, Türkiye

Restricted access

Walsh, P. S., Metzger, D. A., Higuchi, R.: Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques, 1991, 10 , 506–13. Higuchi R

Restricted access

), dNTP Mix 10 mM (2 μL) and Reaction Buffer 5 × (4 μL). Then, samples were incubated for 10 min at 25 °C, 90 min at 42 °C and 5 min at 75 °C. Quantitative real-time PCR data analysis To determine the relative expression of HIF1-α, PDK-4, MCT-4 and GLUT-1

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors:
Yosra Chebbi
,
Siwar Frigui
,
Anis Raddaoui
,
Dorra Belloumi
,
Amel Lakhal
,
Lamia Torjemane
,
Nour Ben Abeljelil
,
Saloua Ladeb
,
Tarek Ben Othmen
,
Rym El Fatmi
, and
Wafa Achour

performed by thermal lysis method using the InstaGene Matrix® kit (Bio-Rad®). The search of the mecA gene and the typing of SCCmec cassettes were performed by polymerase chain reaction (PCR) amplification as previously described [ 7–9 ]. Molecular typing

Restricted access

A hajas sejtes leukémia korszerű diagnosztikája és kezelése

Hairy cell leukemia: diagnosis and treatment

Hematológia–Transzfuziológia
Authors:
Gabriella Illyés
,
Botond Timár
,
Csaba Bödör
,
Judit Demeter
, and
Noémi Nagy

using a sensitive pyrosequencing assay. Am J Clin Pathol. 2012; 138: 153–156. 25 Guerrini F, Paolicchi M, Ghio F, et al. The droplet digital PCR: A

Open access
Acta Microbiologica et Immunologica Hungarica
Authors:
Malek Namaki Kheljan
,
Malihe Hassanzadeh
,
Mehran Srdari Jabedar
,
Ali Mohammadi Gollou
,
Parastoo Ashouri
,
Roghayeh Teimourpour
, and
Mohsen Arzanlou

with Ardabil University of Medical Sciences, previously [ 23 ]. According to ERIC-PCR analysis, the isolates belonged to 24 heterogeneous clusters. More than half (57%) of the isolates were from tracheal specimens, while the remaining were from

Restricted access