Search Results
This study, carried out in 13 sheep flocks of central-western Mexico, aimed to identify the prevalence of anti-N. caninum antibodies, to develop a risk analysis of the infection and to estimate the prevalence of parasite DNA in blood. A total of 368 serum and blood samples were subjected to ELISA and PCR tests, respectively, and the association between the prevalence of antibodies and some management factors was estimated. The overall prevalence of anti-N. caninum antibodies was 13.5% [50/368; 95% confidence interval (CI) 10–17], ranging from 2.7 to 90% per flock, and 92% of the farms had seropositive animals. In ewes the prevalence was 14% (48/348, 95% CI 10–17) and in rams 10% (2/20; 95% CI 1– 33). The mean prevalence of Neospora DNA in blood was 27% (99/368, 95% CI 22–31), implying a range between 16 and 82%. In rams, the prevalence was 5% (1/20 95% CI 2–26), while in ewes it was 28% (98/348, 95% CI 23–33). The agreement between the tests was k = 0.19. The presence of other domestic animal species in the farms [odds ratio (OR) 4.4] and the consumption of placental debris, fetuses and stillborn lambs by dogs living in the farms (OR 5.8) were demonstrated to be risk factors.
Hepatitis A and hepatitis E are enteric transmitted viral diseases occurring in epidemic and sporadic forms especially in developing countries. Previous studies in Turkey showed that most residents are infected with HAV by the second decade of life. Since HEV is generally transmitted by the same route as HAV we conducted a community-based seroprevalence study for HAV and HEV infection in Ahatli area in Antalya, Turkey where socioeconomic conditions are low. Anti-HAV total immunoglobulin was tested by using a microparticle EIA (Axsym-Abbott Lab). Anti-HEV IgG was assayed by a micro ELISA method (Genelabs-Singapore). Of the 338 sera tested, 112 (33.1%) were positive for anti-HAV total antibody. Anti-HEV Ig G was detected in three (0.89%) of the serum samples. Seropositivity rates of HAV in preschool and school children were 19.9% and 43.9% respectively (p<0.001). No antibody to HEV was detected in preschool children, while the prevalence of anti-HEV Ig G was 1.6% in children attending school. Our data showed that seroprevalence of anti-HAV is high among children samples but HEV infection appears to be relatively rare in pediatric age groups.
The current method to detect antibody titre against infectious bursal disease virus (IBDV) in chickens is based on enzyme-linked immunosorbent assay (ELISA) using whole virus as coating antigen. Coating the ELISA plates requires a purified or at least semi-purified preparation of virus as antigen, which needs special skills and techniques. In this study, instead of using whole virus, recombinant protein of hexahistidine tag (His 6 tag) and VPX protein of IBDV expressed in E. coli was used as an alternative antigen to coat the ELISA plates. There was a good correlation coefficient (R 2 = 0.972) between the results of the ELISA using plates coated with monoclonal antibody against His 6 tag and those of the commercial IBDV ELISA kit. Hence, His 6 tag and VPX recombinant protein expressed in E. coli has the potential for the development of ELISA for the measurement of IBDV-specific antibody.
-infected ferrets have low, transient concentrations of microfilariae, making microfilaria detection tests unreliable. However, the detection of microfilariae provides definitive evidence of infection ( McCall, 1998 ). Enzyme-linked immunosorbent assay (ELISA) based
) have been used as serological diagnostic antigens of bTB ( Cho et al., 2007, 2009; Garbaccio et al., 2019; Infantes-Lorenzo et al., 2019; Souza et al., 2019 ). Recently, ELISA kits using Mb2900 (MPB70) and Mb2898 (MPB83) recombinant protein antigens
Aldrich) as substrate at 37 o C. The p-nitrophenol formed was determined by measuring absorbance at 405 nm [ 25 ]. ELISA ELISA was performed by the method of Engvall and Perlmann [ 26 ]. Samples were coated in a 96-well plate and kept overnight at 37 °C
buffaloes. The blood samples were tested with commercial enzyme-linked immunosorbent assay (ELISA) kits (ID Screen® Q Fever Indirect Multispecies, IDVet Inc., Grabels, France) used according to the manufacturer’s instructions. Cattle, goat and sheep farms
using an enzyme-linked immunosorbent assay (ELISA). Furthermore, we evaluated the reactivity of the specific antibody to several chicken tissues by western blot analysis. Materials and methods
) CACTGCCTGAGACCTTGTTGT (R) TTAAAGTCCACTTGATGGAGCC PERK: (F) AGTCCCTGCTCGAATCTTCCT (R) TCCCAAGGCAGAACAGATATACC ELISA assay Briefly, 100 mg of the testis tissue was weighed, homogenized, and added 1 mL phosphate buffer. It then was centrifuged (3,000–4,000 rpm for 20 min
Table 1 . IFN- γ detection in the supernatant of cultured PBMCs using ELISA IFN-γ in the culture supernatant was assessed by using a commercial ELISA kit (Human IFN gamma ELISA Ready-SET-Go, ebioscience, USA) (sensitivity: 4 pg/mL) based on the
