Search Results

You are looking at 51 - 60 of 64 items for :

  • "melting curves" x
  • Refine by Access: All Content x
Clear All
Acta Microbiologica et Immunologica Hungarica
Authors: Károly Péter Sárvári, József Sóki, Miklós Iván, Cecilia Miszti, Krisztina Latkóczy, Szilvia Zsóka Melegh, and Edit Urbán

DNA templates. StepOne RT-PCR machine (Applied Biosystems, USA) was used for the PCR cycling and detection: 95 °C for 10 min, followed by 35 cycles of 95 °C for 15 s, 56 °C for 20 s, 72 °C for 30 s, and 1 cycle of 72 °C for 75 s and a melting curve

Restricted access

the area under the melting curves depend on the heating rate [ 32 ]. The multiple melting behavior was explained by the melting of triacylglycerides (TAG) with different melting peaks and crystal reorganization effects. However, many of those enthalpy

Restricted access

Melting curves of a PP and PPML blends b 95/5, c 90/10, d 85/15, e 80/20, f 75/25 Table 3 Melting parameter of pure PP and PPML blends

Restricted access

point is ambiguous, since for pure water the crystallization point was found to be −22 °C. In turn, in the process of butter heating (the melting curve, Fig. 1 ), endothermic transitions connected with the solid–liquid phase transition take place. At a

Open access

electric STUART SMP3 Melting Point Apparatus and also from DSC curves. The calibration of DSC was made using the melting curves of two pure substances (indium and tin) in the same conditions as the experiments (onset temperature of the melting peak: 156

Restricted access

Melting curves of fats extracted from powdered baby formulas The melting thermograms of the fat from the agglomerated baby formulas were very similar to those of the corresponding fat from the powder mixtures. All

Restricted access

liquid can dissolve 123 and this appears to be related very strongly to the yttrium content of such liquid. From inspection of the densification/melting curves for temperatures near the peritectic point, it is clear that certain compositions do not

Restricted access

confirm the specificity of the amplification reactions, a melting curve was recorded. Each sample was replicated three times; the value of the threshold cycle (Ct) was the same as that of the corresponding mean. The relative fold expression of each mRNA

Open access

: TTGCTTATTGGTGTTGCTGCC; Rev: CAACATTCCCACACACTGCAG For Tbp (TATA-box binding protein): Fw: ACTCCTGCCACACCAGCC; Rev: GGTCAAGTTTACAGCCAAGATTCA The specificity of PCR products was confirmed by analysis of a melting curve. Real-time PCR amplifications were performed on a

Restricted access
Journal of Thermal Analysis and Calorimetry
Authors: Jiří Kučerík, Petra Bursáková, Alena Průšová, Lucie Grebíková, and Gabriele Ellen Schaumann

mannan where peak number was reduced in the second and third heating cycle [ 9 ]. Hydration state after 21 days Figure 3 reports the change of the DSC melting curves of SRFA at W c = 0.51 during the

Restricted access