Search Results
-linked immunosorbent assay (ELISA) snap tests are widely used, which detect the p27 antigen of FeLV and antibodies against the p24 protein of FIV. The American Association of Feline Practitioners (AAFP) prepared a guideline in 2008 (and updated it in 2020) about the
Abstract
Background
Gambling and gaming disorders have been included as “disorders due to addictive behaviors” in the International Classification of Diseases (ICD-11). Other problematic behaviors may be considered as “other specified disorders due to addictive behaviors (6C5Y).”
Methods
Narrative review, experts' opinions.
Results
We suggest the following meta-level criteria for considering potential addictive behaviors as fulfilling the category of “other specified disorders due to addictive behaviors”:
1. Clinical relevance: Empirical evidence from multiple scientific studies demonstrates that the specific potential addictive behavior is clinically relevant and individuals experience negative consequences and functional impairments in daily life due to the problematic and potentially addictive behavior.
2. Theoretical embedding: Current theories and theoretical models belonging to the field of research on addictive behaviors describe and explain most appropriately the candidate phenomenon of a potential addictive behavior.
3. Empirical evidence: Data based on self-reports, clinical interviews, surveys, behavioral experiments, and, if available, biological investigations (neural, physiological, genetic) suggest that psychological (and neurobiological) mechanisms involved in other addictive behaviors are also valid for the candidate phenomenon. Varying degrees of support for problematic forms of pornography use, buying and shopping, and use of social networks are available. These conditions may fit the category of “other specified disorders due to addictive behaviors”.
Conclusion
It is important not to over-pathologize everyday-life behavior while concurrently not trivializing conditions that are of clinical importance and that deserve public health considerations. The proposed meta-level-criteria may help guide both research efforts and clinical practice.
and varieties of cereals infected ( Adhikari et al., 2020 ). Several diagnostic tools have been applied for detection of these viruses, the most common are ELISA ( Belkahla and Lapierre, 1999 ) and RT-PCR of the coat protein (CP) gene ( Malmstrom
The current method to detect antibody titre against infectious bursal disease virus (IBDV) in chickens is based on enzyme-linked immunosorbent assay (ELISA) using whole virus as coating antigen. Coating the ELISA plates requires a purified or at least semi-purified preparation of virus as antigen, which needs special skills and techniques. In this study, instead of using whole virus, recombinant protein of hexahistidine tag (His 6 tag) and VPX protein of IBDV expressed in E. coli was used as an alternative antigen to coat the ELISA plates. There was a good correlation coefficient (R 2 = 0.972) between the results of the ELISA using plates coated with monoclonal antibody against His 6 tag and those of the commercial IBDV ELISA kit. Hence, His 6 tag and VPX recombinant protein expressed in E. coli has the potential for the development of ELISA for the measurement of IBDV-specific antibody.
Aldrich) as substrate at 37 o C. The p-nitrophenol formed was determined by measuring absorbance at 405 nm [ 25 ]. ELISA ELISA was performed by the method of Engvall and Perlmann [ 26 ]. Samples were coated in a 96-well plate and kept overnight at 37 °C
collection and determination of tear MMP-9 concentration using an enzyme-linked immunosorbent assay (ELISA) kit The schedule of tear collection was set up as per the degree of corneal re-epithelialisation using a fluorescein staining test. The fluorescence
24 h. Transfected cells were then subjected to infections with the different bacterial strains ( Table 1 ). ELISA immunoassay For investigation of IL-8 levels released from AGS cells upon infection
enzyme-linked immunosorbent assay (ELISA). Immunogenicity studies in rabbits White New Zealand female rabbits (Pasteur Institute of Iran) aged 3–4 months were randomly divided into three groups (6 rabbits each). In a dose escalation study, two doses of
indicated with a dark coloured background and the names of the three counties Serological methods Serum samples were tested by ELISA method using the HEV Ab (version Ultra, Dia.Pro Diagnostic Bioprobes, Sesto San Giovanni, Italy) and HEV IgM (Dia
) CACTGCCTGAGACCTTGTTGT (R) TTAAAGTCCACTTGATGGAGCC PERK: (F) AGTCCCTGCTCGAATCTTCCT (R) TCCCAAGGCAGAACAGATATACC ELISA assay Briefly, 100 mg of the testis tissue was weighed, homogenized, and added 1 mL phosphate buffer. It then was centrifuged (3,000–4,000 rpm for 20 min
