Search Results

You are looking at 1 - 5 of 5 items for :

  • "primer sets" x
  • User-accessible content x
Clear All
Orvosi Hetilap
Authors: Barbara Kinga Barták, Zsófia Brigitta Nagy, Sándor Spisák, Zsolt Tulassay, Magdolna Dank, Péter Igaz and Béla Molnár

Absztrakt:

Bevezetés: A sejten kívüli szabad DNS-t már az 1940-es években kimutatták. Eredetéről több elmélet is létezik: lehetséges folyamat a tumoros sejtekből, valamint ezzel párhuzamosan az egészséges sejtekből történő felszabadulás is. Célkitűzés: Munkánk célja a szabad DNS felszabadulási ütemének vizsgálata volt SHO-egér/HT-29 humán colorectalis adenocarcinoma sejtvonal xenograftmodellben, valamint célul tűztük ki egészséges és C38 tumorral oltott C57BL/6-os egerek véráramába juttatott mesterségesen fölszaporított metilált és nem metilált DNS-szakaszok lebomlásának nyomon követését. Módszer: SHO-egerekre HT-29 sejteket oltottunk subcutan, majd vért vettünk 8 héten keresztül. A plazma szeparálása után DNS-t izoláltunk, majd mitokondriális és genomiális RT-PCR-próbákkal megállapítottuk a humán/egér DNS-arányt. A szabad DNS lebomlásának vizsgálatához egészséges és C38 tumorsejttel oltott C57BL/6-os állatok vérébe 3000 bázispár (bp) méretű in vitro metilált és nem metilált DNS-fragmentumot juttattunk. Az amplikonok degradációját 19 valós idejű PCR-próbával mértük, a bomlás ütemére a relatív amplikonkoncentrációk alapján következtettünk. Eredmények: A tumorból származó humán DNS mennyisége a 2. hétig a kimutathatósági határ alatt volt, majd a 3. héttől folyamatos emelkedést tapasztaltunk, amely a 8. hétre 18,26%-ot ért el. A véráramba juttatott DNS-szakaszok lebomlásának sebességében különbséget mutattunk ki a nem metilált és a metilált fragmentumok között. Az egészséges állatokban a nem metilált DNS 6 óra után eltűnt a vérplazmából, míg a metilált fragmentum szakaszai 24 óra múlva is kimutathatók voltak. Tumoros állatokban a degradáció mértéke lelassult, és mindkét forma kimutathatóvá vált 24 óra elteltével. Következtetés: A szabad DNS szerepének és hatásmechanizmusának vizsgálatát egyre nagyobb érdeklődés övezi. Munkánk segítséget nyújthat a DNS felszabadulásának és degradációjának pontosabb megismeréséhez. Orv Hetil. 2018; 159(6): 223–233.

Open access

gene due to its strong recommendation by Coker and Davies [ 22 ]. A primer set used for studying α-Tubulin expression was the same as used by Xu and Shi [ 23 ], at their recommended thermocyclic conditions in GeneAmp-2700 thermocycler (Applied

Open access

buffer and used for PCR amplification. To detect the major SE genes ( sea , seb , sec , sed , and see ), multiplex PCR protocols were performed using the primer sets of the European Union Reference Laboratory for Coagulase-Positive Staphylococci (EURL

Open access
European Journal of Microbiology and Immunology
Authors: Markus Krohn, Thomas Wanek, Marie-Claude Menet, Andreas Noack, Xavier Declèves, Oliver Langer, Wolfgang Löscher and Jens Pahnke

photometrically. cDNA was synthesized using the High Capacity RNA-to-cDNA Kit (Applied Biosystems, USA). Gene expression was analyzed with qRT-PCR using TaqMan Hybridization Probes. Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB

Open access
Acta Microbiologica et Immunologica Hungarica
Authors: Orsolya Nagy, Anna Nagy, Szilvia Tóth, Bernadett Pályi, Anita Vargáné Koroknai and Mária Takács

primer sets specific for the 269 nt sequence of the NS3 and NS4A overlapping region of the viral genome (primer sequences are the following: first-round forward primer: CTGGCTTGAAGCAAGAATGC; first-round reverse primer: GGTCTCTAGGGTCTCCGGCA; second

Open access