), 191 – 198 . 10.1016/j.foodchem.2004.02.025 Soares , A.R ., Robaina , M.C.S ., Mendes , G.S ., Silva , T.S.L ., Gestinari , L.M.S ., & Romanos , M.T.V . ( 2012 ): Antiviral activity of extracts from Brazilian seaweeds against herpes simplex
, http://arxiv.org/pdf/1212.2544 Kim, J. and Reisner, S. , Local minimality of the volume-product at the simplex, http://arxiv.org/pdf/1001.0217v1 , Mathematika 57 (2011), 121–134. MR 2012a :52023
Acyclovir ( Figure 1 ) is an antiviral drug from the class of antimetabolites that was discovered in 1977. It is used for the treatment of herpes simplex virus infections, chickenpox, and shingles. Other uses include prevention of cytomegalovirus infections
, India, with melt flow index of 4.26 g/10 min at 210 °C and a 2.16 kg load. Lignin was isolated from the black liquor provided by Simplex Paper Mills Gondia, Maharashtra state, India. All other reagents were AR/GR grade supplied by Merck India
, respectively, PCR thermal profile was as follows: 10 min at 95 °C and 32 cycles of amplification consisting of 45 s at 94 °C, 45 s at 53 °C and 1 min at 72 °C, and an additional 10 min at 72 °C for the final extension [ 21–23 ]. Simplex PCR for detection of
-F AAAATCTGGGTACGCAAACG 271 SPM-R ACATTATCCGCTGGAACAGG A simplex PCR
concentrations as a function of time. The simplex method of optimization [ 28 ] was applied to minimize an objective function defined as the sum of the absolute squared differences between experimental and calculated results. A fourth order Runge–Kutta method
's instructions (Qiagen, USA). OXA-48, KPC, NDM-1, IMP, and VIM-1 carbapenemases were identified by PCR amplification and sequencing as described previously [ 14 ]. The colistin resistant isolates were screened by simplex PCRs for the presence of mcr-1, mcr-2
. D EYOUNG , C. G. , G RAZIOPLENE , R. G. , & P ETERSON , J. B. ( 2012 ). From madness to genius: The Openness/Intellect trait domain as a paradoxical simplex . Journal of Research in Personality , 46 ( 1 ), 63 – 78
BT : Role of miR-132 in angiogenesis after ocular infection with herpes simplex virus . Am. J. Pathol. 181 , 525 – 534 ( 2012 ) 10.1016/j.ajpath.2012.04.014 24