Search Results

You are looking at 121 - 130 of 139 items for :

  • All content x
Clear All

), 191 – 198 . 10.1016/j.foodchem.2004.02.025 Soares , A.R ., Robaina , M.C.S ., Mendes , G.S ., Silva , T.S.L ., Gestinari , L.M.S ., & Romanos , M.T.V . ( 2012 ): Antiviral activity of extracts from Brazilian seaweeds against herpes simplex

Restricted access

, http://arxiv.org/pdf/1212.2544 Kim, J. and Reisner, S. , Local minimality of the volume-product at the simplex, http://arxiv.org/pdf/1001.0217v1 , Mathematika 57 (2011), 121–134. MR 2012a :52023

Restricted access
Acta Chromatographica
Authors: Aneta Cernikova, Pavel Bobal, Janette Bobalova, Jiri Dohnal, and Josef Jampilek

Acyclovir ( Figure 1 ) is an antiviral drug from the class of antimetabolites that was discovered in 1977. It is used for the treatment of herpes simplex virus infections, chickenpox, and shingles. Other uses include prevention of cytomegalovirus infections

Open access

, India, with melt flow index of 4.26 g/10 min at 210 °C and a 2.16 kg load. Lignin was isolated from the black liquor provided by Simplex Paper Mills Gondia, Maharashtra state, India. All other reagents were AR/GR grade supplied by Merck India

Restricted access

, respectively, PCR thermal profile was as follows: 10 min at 95 °C and 32 cycles of amplification consisting of 45 s at 94 °C, 45 s at 53 °C and 1 min at 72 °C, and an additional 10 min at 72 °C for the final extension [ 21–23 ]. Simplex PCR for detection of

Restricted access

-F AAAATCTGGGTACGCAAACG 271 SPM-R ACATTATCCGCTGGAACAGG A simplex PCR

Restricted access
Reaction Kinetics, Mechanisms and Catalysis
Authors: Cristina Benincá, Patrício Peralta-Zamora, Ronaldo Cardoso Camargo, Célia Regina Granhen Tavares, Everton Fernando Zanoelo, and Luciana Igarashi-Mafra

concentrations as a function of time. The simplex method of optimization [ 28 ] was applied to minimize an objective function defined as the sum of the absolute squared differences between experimental and calculated results. A fourth order Runge–Kutta method

Restricted access

's instructions (Qiagen, USA). OXA-48, KPC, NDM-1, IMP, and VIM-1 carbapenemases were identified by PCR amplification and sequencing as described previously [ 14 ]. The colistin resistant isolates were screened by simplex PCRs for the presence of mcr-1, mcr-2

Open access

. D EYOUNG , C. G. , G RAZIOPLENE , R. G. , & P ETERSON , J. B. ( 2012 ). From madness to genius: The Openness/Intellect trait domain as a paradoxical simplex . Journal of Research in Personality , 46 ( 1 ), 63 – 78

Restricted access

BT : Role of miR-132 in angiogenesis after ocular infection with herpes simplex virus . Am. J. Pathol. 181 , 525 – 534 ( 2012 ) 10.1016/j.ajpath.2012.04.014 24

Restricted access