), 191 – 198 . 10.1016/j.foodchem.2004.02.025 Soares , A.R ., Robaina , M.C.S ., Mendes , G.S ., Silva , T.S.L ., Gestinari , L.M.S ., & Romanos , M.T.V . ( 2012 ): Antiviral activity of extracts from Brazilian seaweeds against herpes simplex
dieselben drei Felder, Stilmittel, lexikalische Struktur und Akustik in seiner Institutio immer noch im Blick: Beim Griechen Lysias erkennt er eine sprachliche gratia , die einem simplex atque inadfectatus color entspringt (9. 4. 17); für die akustische
An unusual exacerbation of chronic obstructive pulmonary disease (COPD) with herpes simplex tracheitis: case report J Med Case Reports 1 91 . 35
-F AAAATCTGGGTACGCAAACG 271 SPM-R ACATTATCCGCTGGAACAGG A simplex PCR
, respectively, PCR thermal profile was as follows: 10 min at 95 °C and 32 cycles of amplification consisting of 45 s at 94 °C, 45 s at 53 °C and 1 min at 72 °C, and an additional 10 min at 72 °C for the final extension [ 21–23 ]. Simplex PCR for detection of
, India, with melt flow index of 4.26 g/10 min at 210 °C and a 2.16 kg load. Lignin was isolated from the black liquor provided by Simplex Paper Mills Gondia, Maharashtra state, India. All other reagents were AR/GR grade supplied by Merck India
BT : Role of miR-132 in angiogenesis after ocular infection with herpes simplex virus . Am. J. Pathol. 181 , 525 – 534 ( 2012 ) 10.1016/j.ajpath.2012.04.014 24
concentrations as a function of time. The simplex method of optimization [ 28 ] was applied to minimize an objective function defined as the sum of the absolute squared differences between experimental and calculated results. A fourth order Runge–Kutta method
's instructions (Qiagen, USA). OXA-48, KPC, NDM-1, IMP, and VIM-1 carbapenemases were identified by PCR amplification and sequencing as described previously [ 14 ]. The colistin resistant isolates were screened by simplex PCRs for the presence of mcr-1, mcr-2
. D EYOUNG , C. G. , G RAZIOPLENE , R. G. , & P ETERSON , J. B. ( 2012 ). From madness to genius: The Openness/Intellect trait domain as a paradoxical simplex . Journal of Research in Personality , 46 ( 1 ), 63 – 78