and K. pneumoniae strains by means of PCR using the primer sets and thermal cycling conditions described in Tables I and II . PCR products were analyzed by electrophoresis in a 1%–1.5% agarose gel. One of the PCR products was purified and direct
-PCR method (primer sequences and protocol available upon request). Fragments of the SBV S and M segments were amplified using the primer sets designed by Fischer et al. [ 5 ], whereas PCR products covering the complete L segment were generated by new
gene due to its strong recommendation by Coker and Davies [ 22 ]. A primer set used for studying α-Tubulin expression was the same as used by Xu and Shi [ 23 ], at their recommended thermocyclic conditions in GeneAmp-2700 thermocycler (Applied
(annealing temperature for each primer set is shown in Table I ), and extension (72 °C for 1 min), and a final extension of 5 min at 72 °C. Ten microliters of reaction mixture containing PCR product was analyzed by gelelectrophoresis in 0.8% (wt/vol) agarose
E. coli -harboring ESBLs and AmpC β-lactamases by PCR technique (Bio Intellectica PCR). The primer sets and thermal cycling conditions described in Tables I and II . One of the PCR products was purified and direct sequencing was performed. Two
). PCR amplification of efrA and efrB genes The presence of efrA and efrB genes was detected by PCR using the sequence-specific primer sets described in Table I . PCR was carried out in a total volume of 25 μL Master mix 2× (Sinaclon
(ITS) gene region amplification ITS gene region amplification was performed using ITS1FʹTCCGTAGGTGAACCTGCGGʹ and ITS1R ʹTCCTCCGCTTATTGATATGCʹ primer sets (IDT, USA and Biomers, Germany) [ 1 ]. ITS gene region sequencing BigDye ® terminator v3.1 Cycle
buffer and used for PCR amplification. To detect the major SE genes ( sea , seb , sec , sed , and see ), multiplex PCR protocols were performed using the primer sets of the European Union Reference Laboratory for Coagulase-Positive Staphylococci (EURL
photometrically. cDNA was synthesized using the High Capacity RNA-to-cDNA Kit (Applied Biosystems, USA). Gene expression was analyzed with qRT-PCR using TaqMan Hybridization Probes. Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB
pGem ® -T Vector System (Promega, Madison, USA) according to manufacturer’s instructions. Insert sequences were amplified using M13 primer sets [ 42 ] followed by nested PCR reaction with the applied specific primers (27F-519R, A340F-A934R, amoA –F1