and K. pneumoniae strains by means of PCR using the primer sets and thermal cycling conditions described in Tables I and II . PCR products were analyzed by electrophoresis in a 1%–1.5% agarose gel. One of the PCR products was purified and direct
-PCR method (primer sequences and protocol available upon request). Fragments of the SBV S and M segments were amplified using the primer sets designed by Fischer et al. [ 5 ], whereas PCR products covering the complete L segment were generated by new
gene due to its strong recommendation by Coker and Davies [ 22 ]. A primer set used for studying α-Tubulin expression was the same as used by Xu and Shi [ 23 ], at their recommended thermocyclic conditions in GeneAmp-2700 thermocycler (Applied
). PCR amplification of efrA and efrB genes The presence of efrA and efrB genes was detected by PCR using the sequence-specific primer sets described in Table I . PCR was carried out in a total volume of 25 μL Master mix 2× (Sinaclon
(annealing temperature for each primer set is shown in Table I ), and extension (72 °C for 1 min), and a final extension of 5 min at 72 °C. Ten microliters of reaction mixture containing PCR product was analyzed by gelelectrophoresis in 0.8% (wt/vol) agarose
E. coli -harboring ESBLs and AmpC β-lactamases by PCR technique (Bio Intellectica PCR). The primer sets and thermal cycling conditions described in Tables I and II . One of the PCR products was purified and direct sequencing was performed. Two
buffer and used for PCR amplification. To detect the major SE genes ( sea , seb , sec , sed , and see ), multiplex PCR protocols were performed using the primer sets of the European Union Reference Laboratory for Coagulase-Positive Staphylococci (EURL
(ITS) gene region amplification ITS gene region amplification was performed using ITS1FʹTCCGTAGGTGAACCTGCGGʹ and ITS1R ʹTCCTCCGCTTATTGATATGCʹ primer sets (IDT, USA and Biomers, Germany) [ 1 ]. ITS gene region sequencing BigDye ® terminator v3.1 Cycle
pGem ® -T Vector System (Promega, Madison, USA) according to manufacturer’s instructions. Insert sequences were amplified using M13 primer sets [ 42 ] followed by nested PCR reaction with the applied specific primers (27F-519R, A340F-A934R, amoA –F1
photometrically. cDNA was synthesized using the High Capacity RNA-to-cDNA Kit (Applied Biosystems, USA). Gene expression was analyzed with qRT-PCR using TaqMan Hybridization Probes. Primer sets with according TaqMan probes for Abcb1a (Mm00440761_m1), human ABCB