Search Results

You are looking at 21 - 25 of 25 items for :

  • "primer sets" x
  • All content x
Clear All

Reverse Transcription Kits, USA). Using specific primer sets ( Table 1 ), aliquots of cDNA were amplified by a PCR machine (Peqlab, Germany), with initial denaturation at 94 °C for 5 min, followed by 33 cycles of denaturation at 94 °C for 45 s, annealing

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors: Mehrdad Mohammadi, Jila Yavarian, Vajihe Karbasizade, Sharareh Moghim, Bahram Nasr Esfahani, and Nafiseh Sadat Hosseini

-Quraishy , S. A. , El Kholy , A. A. : A novel primer set for improved direct gene sequencing of human bocavirus genotype-1 from clinical samples . J Virol Methods 228 , 108 – 113 ( 2016 ). 10.1016/j

Restricted access

gel at 100 V for 60 min and were staining with safe stain. Table I. Primer sets used in this study

Restricted access
Acta Veterinaria Hungarica
Authors: Mohsen Bashashati, Zohreh Mojahedi, Ali Ameghi Roudsari, Morteza Taghizadeh, Aidin Molouki, Najmeh Motamed, Fereshteh Sabouri, and Mohammad Hossein Fallah Mehrabadi

editor and analysis program for Windows 95/98/NT . Nucleic Acids Symp. Ser. 41 , 95 – 98 . Hoffmann , E. , Stech , J. , Guan , Y. , Webster , R. G. and Perez , D. R ( 2001 ): Universal primer set for the full-length amplification of all

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors: Orsolya Nagy, Anna Nagy, Szilvia Tóth, Bernadett Pályi, Anita Vargáné Koroknai, and Mária Takács

primer sets specific for the 269 nt sequence of the NS3 and NS4A overlapping region of the viral genome (primer sequences are the following: first-round forward primer: CTGGCTTGAAGCAAGAATGC; first-round reverse primer: GGTCTCTAGGGTCTCCGGCA; second

Open access