Search Results

You are looking at 31 - 40 of 57 items for :

  • "restriction enzymes" x
  • All content x
Clear All

. 60 2963 2970 Raue, R. and Hess, M. (1998): Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of

Restricted access

BLAD alleles by multiplex PCR followed by parallel digestion with two restriction enzymes. Anim. Genet. 27 , 207-209. Simultaneous analysis of bovine k -casein and BLAD alleles by multiplex PCR followed by parallel digestion

Restricted access

25 803 Majoros, L., Kardos, G., Belák, Á., Maráz, A., Asztalos, L., Csánky, E., Barta, Z., Szabó, B.: Restriction enzyme analysis of ribosomal DNA

Restricted access

310 Liu, X., Shi, T., Ren, H., Su, H., Yan, W. and Suo, X. (2008): Restriction enzyme-mediated transfection improved transfection efficiency in vitro in Apicomplexan parasite Eimeria

Restricted access

FP22, a large streptomycete bacteriophage with DNA insensitive to cleavage by many restriction enzymes. J Gen Microbiol 136 , 2395 (1990). Baltz R.H. Characterization of FP22, a

Restricted access

.L. (1987): Restriction enzyme analysis of lactose and bacteriocin plasmids from Streptococcus lactis subsp. diacetylactis WM4 and cloning of Bc/I fragments coding for bacteriocin production. Appl. environ. Microbiol. , 53 , 1171

Restricted access

41 Messelson, M., Yuan, R. 1968. DNA restriction enzyme from E. coli . Nature 217 :1110–1114. Yuan R. DNA

Restricted access

1998 249 307 315 Raue, R. and Hess, M. (1998): Hexon based PCRs combined with restriction enzyme analysis for rapid

Restricted access

(5′->3′) Restriction enzyme Product size (bp) rs9939609 T>A F: TAGGTTCCTTGCGACTGCTGTGAACTT

Restricted access

., 2018 ). Briefly, partial rpoD amplicons were cut by the AluI restriction enzyme for separation on DNA 1000 chip using Agilent 2100 Bioanalyser. Digested patterns were compared with the in silico digestion patterns of 27 type strains for

Restricted access