Search Results

You are looking at 51 - 57 of 57 items for :

  • Medical and Health Sciences x
  • All content x
Clear All

. 143 625 629 Blessing WW, Li YW, Wesselingh SL: Transneuronal transport of Herpes Simplex Virus from the cervical vagus to brain neurons with axonal

Restricted access

factors expression [ 28 ], suggesting an impact on the effector functions of NK cells. Results previously published by our group with different herpesvirus, herpes simplex type 1 and HHV-8, show that the expression of a specific inhibitory NK cell

Restricted access

, respectively, PCR thermal profile was as follows: 10 min at 95 °C and 32 cycles of amplification consisting of 45 s at 94 °C, 45 s at 53 °C and 1 min at 72 °C, and an additional 10 min at 72 °C for the final extension [ 21–23 ]. Simplex PCR for detection of

Restricted access

-F AAAATCTGGGTACGCAAACG 271 SPM-R ACATTATCCGCTGGAACAGG A simplex PCR

Restricted access

BT : Role of miR-132 in angiogenesis after ocular infection with herpes simplex virus . Am. J. Pathol. 181 , 525 – 534 ( 2012 ) 10.1016/j.ajpath.2012.04.014 24

Restricted access

. Moreover, when herpes simplex virus-1 vectors that overexpressed CREB were injected into rat NAc, CART mRNA expression increased ( 27 ). Main nAChR subunits expressed on undifferentiated and differentiated PC12 cells are α3, α5, α7, β2, and β4 ( 21

Restricted access

neuropathological findings. Dias et al. injected Herpes simplex virus–green fluorescence protein into experimental mice of 7–9 weeks of age and found that the mice presented similarities to the social avoidance phenotype of depression. The overexpression of β

Restricted access