-Quraishy , S. A. , El Kholy , A. A. : A novel primer set for improved direct gene sequencing of human bocavirus genotype-1 from clinical samples . J Virol Methods 228 , 108 – 113 ( 2016 ). 10.1016/j
Reverse Transcription Kits, USA). Using specific primer sets ( Table 1 ), aliquots of cDNA were amplified by a PCR machine (Peqlab, Germany), with initial denaturation at 94 °C for 5 min, followed by 33 cycles of denaturation at 94 °C for 45 s, annealing
gel at 100 V for 60 min and were staining with safe stain. Table I. Primer sets used in this study
editor and analysis program for Windows 95/98/NT . Nucleic Acids Symp. Ser. 41 , 95 – 98 . Hoffmann , E. , Stech , J. , Guan , Y. , Webster , R. G. and Perez , D. R ( 2001 ): Universal primer set for the full-length amplification of all
primer sets specific for the 269 nt sequence of the NS3 and NS4A overlapping region of the viral genome (primer sequences are the following: first-round forward primer: CTGGCTTGAAGCAAGAATGC; first-round reverse primer: GGTCTCTAGGGTCTCCGGCA; second