Search Results

You are looking at 1 - 10 of 18 items for :

  • "primer sets" x
  • Medical and Health Sciences x
Clear All
Acta Veterinaria Hungarica
Authors: Hakan Işidan, Turhan Turan, Mustafa Ozan Atasoy, Ibrahim Sözdutmaz and Bünyamin Irehan

The involvement of picornaviruses in calf diarrhoea was evaluated by the analysis of 127 faecal samples collected from diarrhoeic calves during 2014–2016. Virus detections were carried out by PCR using generic or specific primer pairs. One-third of the faecal samples (33.86%) were found to be positive for one or more of the studied viruses. Bovine kobuvirus was detected in 22.83%, bovine hungarovirus in 11.02%, while bovine enterovirus 1 in 5.51% of the samples. The sequences of the PCR products indicated the existence of novel variants in all the three virus species. When comparing the partial sequences, the nucleotide sequence identities between our newly detected viruses and those previously deposited to the GenBank ranged between 76 and 99%. Phylogenetic analyses revealed a novel lineage within the species Hunnivirus A. Our findings suggest that these viruses should be regarded as possible aetiological agents of calf diarrhoea. Based on the newly determined sequences, we designed and tested a new generic PCR primer set for the more reliable detection of bovine hungaroviruses. This is the first report on the molecular detection of the presence of bovine hungarovirus, bovine kobuvirus and bovine enterovirus 1 in the faecal samples of diarrhoeic calves in Turkey.

Restricted access

A history of having substantial Chlamydia trachomatis exposure as detected by serum antibodies is a cofactor of human papillomavirus (HPV) mediated cervical carcinogenesis. In this study, we examined the concurrent C. trachomatis infections in cytologic atypia of the uterine cervix in order to evaluate the impact of C. trachomatis infection in patients with high risk for cervical intraepithelial neoplasia. Cervical scrapes form 707 patients were subjected to PCR amplification with primer sets for HPV and C. trachomatis . Based on negative beta-globin results, 10 specimens were not eligible for further analysis. Oncogenic HPV types were detected in 278 specimens (39.8%). C. trachomatis was found only in six specimens (0.9%). In conclusion, concurrent C. trachomatis infection was uncommon and hence it was an improbable risk factor in cytologic atypia.

Restricted access
Orvosi Hetilap
Authors: Barbara Kinga Barták, Zsófia Brigitta Nagy, Sándor Spisák, Zsolt Tulassay, Magdolna Dank, Péter Igaz and Béla Molnár

Absztrakt:

Bevezetés: A sejten kívüli szabad DNS-t már az 1940-es években kimutatták. Eredetéről több elmélet is létezik: lehetséges folyamat a tumoros sejtekből, valamint ezzel párhuzamosan az egészséges sejtekből történő felszabadulás is. Célkitűzés: Munkánk célja a szabad DNS felszabadulási ütemének vizsgálata volt SHO-egér/HT-29 humán colorectalis adenocarcinoma sejtvonal xenograftmodellben, valamint célul tűztük ki egészséges és C38 tumorral oltott C57BL/6-os egerek véráramába juttatott mesterségesen fölszaporított metilált és nem metilált DNS-szakaszok lebomlásának nyomon követését. Módszer: SHO-egerekre HT-29 sejteket oltottunk subcutan, majd vért vettünk 8 héten keresztül. A plazma szeparálása után DNS-t izoláltunk, majd mitokondriális és genomiális RT-PCR-próbákkal megállapítottuk a humán/egér DNS-arányt. A szabad DNS lebomlásának vizsgálatához egészséges és C38 tumorsejttel oltott C57BL/6-os állatok vérébe 3000 bázispár (bp) méretű in vitro metilált és nem metilált DNS-fragmentumot juttattunk. Az amplikonok degradációját 19 valós idejű PCR-próbával mértük, a bomlás ütemére a relatív amplikonkoncentrációk alapján következtettünk. Eredmények: A tumorból származó humán DNS mennyisége a 2. hétig a kimutathatósági határ alatt volt, majd a 3. héttől folyamatos emelkedést tapasztaltunk, amely a 8. hétre 18,26%-ot ért el. A véráramba juttatott DNS-szakaszok lebomlásának sebességében különbséget mutattunk ki a nem metilált és a metilált fragmentumok között. Az egészséges állatokban a nem metilált DNS 6 óra után eltűnt a vérplazmából, míg a metilált fragmentum szakaszai 24 óra múlva is kimutathatók voltak. Tumoros állatokban a degradáció mértéke lelassult, és mindkét forma kimutathatóvá vált 24 óra elteltével. Következtetés: A szabad DNS szerepének és hatásmechanizmusának vizsgálatát egyre nagyobb érdeklődés övezi. Munkánk segítséget nyújthat a DNS felszabadulásának és degradációjának pontosabb megismeréséhez. Orv Hetil. 2018; 159(6): 223–233.

Open access

Cholera is a serious epidemic and endemic disease caused by the Gram-negative bacterium Vibrio cholerae. SXT is an integrative conjugation element (ICE) that was isolated from a V. cholerae; it encodes resistance to the antibiotics chloramphenicol, streptomycin and sulfamethoxazole/trimethoprim. One hundred seven V. cholerae O1 strains were collected from cholera patients in Iran from 2005 to 2007 in order to study the presence of SXT constin and antibiotic resistance.The study examined 107 Vibrio cholerae strains isolated from cholera prevalent in some Iranian provinces. Bacterial isolation and identification were carried out according to standard bacteriological methods. Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) to four antibiotics (chloramphenicol, streptomycin, sulfamethoxazole, and trimethoprim) were determined by broth microdilution method. PCR was employed to evaluate the presence of established antibiotic resistance genes and SXT constin using specific primer sets.The resistance of the clinical isolates to sulfamethoxazole, trimethoprime, chloramphenicol, and streptomycin was 97%, 99%, 99%, and 90%, respectively. The data obtained by PCR assay showed that the genes sulII, dfrA1, floR, strB, and sxt element were present in 95.3%, 95.3%, 81.3%, 95.3%, and 95.3% of the V. cholerae isolates.The Vibrio strains showed the typical multidrug-resistance phenotype of an SXT constin. They were resistant to sulfamethoxazole, trimethoprime, chloramphenicol, and streptomycin. The detected antibiotic resistance genes included dfrA for trimethoprim and floR, strB, sulII and int, respectively, for chloramphenicol, streptomycin, sulfamethoxazole, as well as the SXT element.

Restricted access
Acta Veterinaria Hungarica
Authors: Hoonsung Choi, Sang In Lee, Shanmugam Sureshkumar, Mi-Hyang Jeon, Jeom Sun Kim, Mi-Ryung Park, Kyung-Woon Kim, Ik-Soo Jeon, Sukchan Lee and Sung June Byun

. Appl. Microbiol. Biotechnol. 99 , 2793 – 2803 . Hoffmann , E. , Stech , J. , Guan , Y. , Webster , R. and Perez , D. ( 2001 ): Universal primer set for the full

Restricted access

(ITS) gene region amplification ITS gene region amplification was performed using ITS1FʹTCCGTAGGTGAACCTGCGGʹ and ITS1R ʹTCCTCCGCTTATTGATATGCʹ primer sets (IDT, USA and Biomers, Germany) [ 1 ]. ITS gene region sequencing BigDye ® terminator v3.1 Cycle

Restricted access

Reverse Transcription Kits, USA). Using specific primer sets ( Table 1 ), aliquots of cDNA were amplified by a PCR machine (Peqlab, Germany), with initial denaturation at 94 °C for 5 min, followed by 33 cycles of denaturation at 94 °C for 45 s, annealing

Restricted access
Acta Veterinaria Hungarica
Authors: Mohsen Bashashati, Zohreh Mojahedi, Ali Ameghi Roudsari, Morteza Taghizadeh, Aidin Molouki, Najmeh Motamed, Fereshteh Sabouri and Mohammad Hossein Fallah Mehrabadi

editor and analysis program for Windows 95/98/NT . Nucleic Acids Symp. Ser. 41 , 95 – 98 . Hoffmann , E. , Stech , J. , Guan , Y. , Webster , R. G. and Perez , D. R ( 2001 ): Universal primer set for the full-length amplification of all

Restricted access
Acta Veterinaria Hungarica
Authors: Ádám Bálint, István Kiss, Krisztián Bányai, Imre Biksi, Katalin Szentpáli-Gavallér, Tibor Magyar, István Jankovics, Mónika Rózsa, Bálint Szalai, Mária Takács, Ádám Tóth and Ádám Dán

84 3752 3758 Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. and Perez, D. R. (2001): Universal primer set for the full-length amplification of

Restricted access

and K. pneumoniae strains by means of PCR using the primer sets and thermal cycling conditions described in Tables  I and II . PCR products were analyzed by electrophoresis in a 1%–1.5% agarose gel. One of the PCR products was purified and direct

Restricted access