Search Results

You are looking at 1 - 10 of 55 items for :

  • "Bacteroides" x
Clear All
Authors: Maja Bogdan, Ljilijana Perić, Katalin Ördög, Dubravka Vuković, Edit Urbán and József Sóki

Introduction Bacteroides fragilis is the most commonly isolated opportunistic anaerobic pathogen, which is also a member of the normal microbiota. It comprizes 60%–80% of the isolated anaerobic pathogens, but gives a

Restricted access
Authors: Károly Péter Sárvári, József Sóki, Miklós Iván, Cecilia Miszti, Krisztina Latkóczy, Szilvia Zsóka Melegh and Edit Urbán

Introduction Although members of the Bacteroides genus are components of the normal microbiota of human gut, these strains are frequently isolated from sepsis, skin and soft tissue, intraabdominal and postoperative wound

Restricted access

Kortt, A. (1986): Clinical and laboratory diagnosis of benign, intermediate and virulent strains of Bacteroides nodosus . In: Stewart, D. J., Peterson, J. E., McKern, N. M. and Emery, D. L. (eds) Foot Rot in Ruminants. Proceedings of a Workshop

Restricted access

expression of carbapenem resistance in clinical isolates of Bacteroides fragilis. Mol. Microbiol. 12 , 105-114. Insertion of a novel DNA sequence, IS1186, upstream of the silent carbapenenase gene, cfiA, promotes expression of

Restricted access

-anaerobic) infections, where the components of the normal bacterial microbiota are seen as pathogens [ 1, 2, 5, 6 ]. The following anaerobes are accountable for the majority (>90%) of clinical infections: Gram-negative rods ( Bacteroides / Parabacteroides spp

Open access

Absztrakt:

Bevezetés: Az anaerob baktériumok fontos etiológiai szerepet töltenek be invazív infekciókban, klinikailag szignifikáns kórokozók véráramfertőzésekben és szeptikémiában, valós prevalenciájukról azonban világszerte, így hazánkban is kevés adat áll rendelkezésre. Célkitűzés: Az anaerob baktériumok által okozott, mikrobiológiai diagnózissal igazolt véráram-infekciók gyakoriságának összefoglaló értékelése a Szegedi Tudományegyetem (SZTE) klinikáin a beküldött hemokultúraminták retrospektív elemzésével. Módszer: A vizsgálat során 5 éves periódus (2013. 01. 01.–2017. 12. 31.) alatt az SZTE klinikáiról beküldött hemokultúraminták elemzése történt; az összehasonlítás alapját egy hasonló időtartamú (2005–2009), ugyanezen központban elvégzett vizsgálat képezte. Eredmények: 2013 és 2017 között átlagosan 23 274 ± 2756 hemokultúrapalack vizsgálata történt meg, melyek közül átlagosan 10,5% volt pozitív, és 0,4% volt pozitív anaerobokra (3,5–3,8/1000 palack). A klinikailag szignifikáns anaerob kórokozók közül a Bacteroides/Parabacteroides csoport (39,9%) és a Clostridium fajok (32,8%) fordultak elő a legnagyobb arányban. Következtetések: Az anaerob baktériumok viszonylag alacsony számuk ellenére fontos etiológiai tényezőknek tekinthetők véráramfertőzésekben. Eredményeink felhívják a figyelmet a modern identifikálómódszerek jelentőségére az adekvát anaerobdiagnosztikában. Orv Hetil. 2020; 161(19): 797–803.

Open access
Authors: Elisabeth Nagy, Edit Urbán, J. Sóki, J. Sóki, Gabriella Terhes and Katalin Nagy

Jousimies-Somer, H., Summanen, P. H., Finegold, S. M.: Bacteroides, Porphyromonas, Prevotella, Fusobacterium , and other anaerobic Gram-negative rods and cocci. In: Murray, P. R., Baron, E. J., Pfaller, M. A., Tenover, F. C., Yolken, R. H. (eds): Manual of

Restricted access
Authors: M. Peterka, Katarina Tepšič, T. Accetto, R. Kostanjšek, Andreja Ramšak, L. Lipoglavšek and G. Avguštin

Dore, J., Sghir, A., Hannequart-Gramet, G., Corthier, G., Pochart, P.: Design and evaluation of a 16S rRNA-targeted oligonucleotide probe for specific detection and quantitation of human faecal Bacteroides populations. System Appl Microbiol 21 , 64

Restricted access
Authors: Annalena Reitz, Sven Poppert, Melanie Rieker and Hagen Frickmann

] Bacteroides spp. 5’-CAT-CCT-TCA-CGC-TAC-TTG-GCT-GG-3’ in combination with the two competitor probes 5’-TCC-TTC-ACG-CGA-CTT-GGC-TGG-TT-3’ and 5’-TCC-TGC-ACG-CTA-CTT-GGC-TGG-T-3’ This study Bacteroides spp. / Prevotella spp. 5’-CAT

Open access
Authors: Nima Mohammadzadeh, Behrooz Sadeghi Kalani, Shahin Bolori, Azadeh Azadegan, Afsaneh Gholami, Rokhsareh Mohammadzadeh and Faramarz Masjedian Jazi

CGCGACGAACCGCCTACGAGC 21 Bacteroides group Primer-F GTATGTCRCAAGCGTTATCC 20 100 This study

Restricted access