Search Results

You are looking at 1 - 10 of 16 items for :

  • "capsular type" x
  • Refine by Access: All Content x
Clear All
European Journal of Microbiology and Immunology
Authors:
Carlos Florindo
,
Cinthia Alves Barroco
,
Inês Silvestre
,
Vera Damião
,
João Paulo Gomes
,
Barbara Spellerberg
,
Ilda Santos-Sanches
, and
Maria José Borrego

activity (qualitatively and quantitatively) in strains of different origin (human and bovine) and different capsular types to evaluate possible associations with genetic features. Materials and Methods Strain Collection

Open access

Sixty-one avian strains of Pasteurella multocida were characterised and compared by biochemical tests, capsular PCR typing and ERIC-PCR. The strains were recovered from various avian species (goose, duck, Muscovy duck, turkey, chicken and pheasant) and represented different geographic locations in Hungary. Forty-two strains (69%) were identified as P. multocida subsp. multocida and 19 strains (31%) as P. multocida subsp. septica . The strains were grouped into 7 different biovars (1, 2, 3, 4, 5, 6 and 7). The most prevalent biovars were 1 (25%), 3 (21%) and 6 (21%). Most of the duck isolates (90%) belonged to biovar 1 or 6. The most frequent capsular type was A (93.5%). Type F represented only a small number (6.5%) of the strains. Other capsular types were not identified. From the 61 isolates 24 different fingerprint patterns were generated by ERIC-PCR assay. Based on cluster analysis the strains could be grouped into four larger and four mini-clusters that showed considerable correlation with the geographical origin and the host species. The results indicate that ERIC-PCR may be a suitable technique for studying the host adaptation of P. multocida and the epidemiology of fowl cholera.

Restricted access

Streptococcus pneumoniae causes life threatening infections and necessitate for impediment and controlling disease; to conquer this, information is needed about serotype distribution and patterns of antibiotic resistance. The present study was to determine the serotype distribution of S. pneumoniae isolated from the entire age group individual and to correlate this distribution with susceptibility. Cases of pneumococcal infections have been reviewed for serotyping and antibiotic susceptibility. Out of 117 pneumococcal isolates 45 (39%) were penicillin-resistant, 84 (72%) were erythromycin-resistant and 100% were co-trimoxazole resistant. The most frequently isolated serotypes were 23F, 19F, 14, 6B, 5, 6A, 19A and 9V. PCV7, PCV10 and PCV13 coverage was 68%, 79%, 87%, respectively. Similarly, there was similarity in PCV7 coverage for non invasive isolates (64.5%) and invasive isolates (72.2%). The study state that common pneumococcal serotypes were present in similar ways as reported in literature. A continuous survey of pneumococcal infected population is requirement and necessity for success of vaccination.

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors:
Hedayat Bozorgi Mohajer
,
Himen Salimizand
,
Dahieh Gharanizadeh
,
Afra Hossainpanahi
, and
Rashid Ramazanzadeh

 al., all isolates were sought for common K. pneumoniae capsular types including k1, k2, k5, k54, k57, k20 [ 13 ]. 2.7 Sequencing and accession numbers To identify variants of bla NDM and bla OXA-48 genes, these genes were sequenced from both sides

Restricted access

Haemorrhagic septicaemia (HS) is an acute, highly fatal and septicaemic disease caused by the capsular types B or E of Pasteurella multocida ( Shivachandra et al., 2011 ). This heterogeneous pathogen is classified into three subspecies ( multocida

Restricted access

, which in some case can increase horizontal gene transfer [ 14 ]. Notwithstanding, the wze and wzi genes revealed that the strain was of the KL-23 and O2afg types, providing more credence to the fact that capsular type might be useful for the further

Restricted access

plate [ 18 ]. All isolates were screened for the presence of capsular types K1, K2 and K20 using PCR method [ 19 ]. The virulence genes including iroB , magA , ybt , alls, rmpA and iucA were detected by specific primers described previously [ 20

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors:
Reza Beigverdi
,
Fereshteh Jabalameli
,
Akbar Mirsalehian
,
Sedigheh Hantoushzadeh
,
Shahram Boroumandi
,
Morovat Taherikalani
, and
Mohammad Emaneini

Forty-one Streptococcus agalactiae isolates collected from pregnant women at 35–37 weeks of gestation were analysed for their capsular types, antimicrobial resistance determinants, distribution of virulence factors and genetic relatedness using PCR and multiplex PCR. Capsular type III was predominant (65.8%), followed by capsular type II (14.6%), Ib (7.3%), and V(4.9%). All isolates were susceptible to penicillin, vancomycin, linezolid and quinupristin-dalfopristin. Resistance to tetracycline, erythromycin and clindamycin were found in 97.6%, 24.4%, and 14.6% of isolates, respectively. The most common antimicrobial resistance gene was tetM found in 97.6% of the isolates followed by ermTR and ermB found in 12% and 7.3% of isolates, respectively. The most common virulence gene was hly (100%), followed by scpB (97.6%), bca (97.6%), rib (53.65%) and bac (4.9%). The insertion sequence IS1548 was found in 63.4% of isolates. By multi locus variable number of tandem repeat analysis (MLVA) typing, 30 different allelic profiles or MLVA types (MTs) were identified. The most frequent was the MT1 (5/41, 12.2%) and followed by MT2 (4/41, 9.75%). Our data revealed that population structure of these isolates is highly diverse and indicates different MLVA types.

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors:
Serra Örsten
,
Selay Demirci-Duarte
,
Tuğçe Ünalan-Altıntop
,
Aslı Çakar
,
Banu Sancak
,
Koray Ergünay
, and
Cumhur Özkuyumcu

, comprising 0.9% of all isolates tested. The sequencing of the amplicon provided a section of the wzc gene and revealed the capsule type as K5, via pairwise sequence comparisons and BLAST analysis. It is known that 79 distinct capsular types exist in

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors:
El Mehdi Belouad
,
Elmostafa Benaissa
,
Nadia El Mrimar
,
Yassine Eddair
,
Adil Maleb
, and
Mostafa Elouennass

identification of K. pneumoniae [ 24 ]. Table 1. List of primers used for detection of K. pneumoniae virulence genes Target Primer Sequence T m o C Product size (bp) Reference Capsular type K1 K1-F1 GTAGGTATTGCAAGCCATGC 59.7 1,047 [ 25 ] K1-R1

Restricted access