Search Results

You are looking at 1 - 10 of 11 items for :

  • Refine by Access: All Content x
Clear All

conditions; and (c) to determine genetic diversity of PGPR isolates by BOX, Enterobacterial Repetitive Intergenic Consensus (ERIC), and repetitive extragenic palindromic polymerase chain reaction (REP-PCR). Materials and Methods

Restricted access
European Journal of Microbiology and Immunology
Authors:
Hagen Frickmann
,
Thomas Köller
,
Ralf Matthias Hagen
,
Klaus-Peter Ebert
,
Martin Müller
,
Werner Wenzel
,
Renate Gatzer
,
Ulrich Schotte
,
Alfred Binder
,
Romy Skusa
,
Philipp Warnke
,
Andreas Podbielski
,
Christian Rückert
, and
Bernd Kreikemeyer

performed, and strains collected were subjected to rep-PCR-based and sequence-based typing to identify potential nosocomial transmission events. Methods Patients Criteria for the inclusion of patients in the retrospective assessment comprised the

Open access
European Journal of Microbiology and Immunology
Authors:
Heike Granzer
,
Ralf Matthias Hagen
,
Philipp Warnke
,
Wolfgang Bock
,
Tobias Baumann
,
Norbert Georg Schwarz
,
Andreas Podbielski
,
Hagen Frickmann
, and
Thomas Koeller

, Koskela S , Mero S , Tarkka E , Tissari P , Vaara M , Kirveskari J : Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and

Open access
Acta Microbiologica et Immunologica Hungarica
Authors:
Mbudzeni Ramashia
,
Thabiso D. Phofa
,
Granny M. Nkawane
,
Noel-David Nogbou
,
John Y. Bolukaoto
,
Maphoshane Nchabeleng
, and
Andrew M. Musyoki

-48_R GCGTGGTTAAGGATGAACAC CATCAAGTTCAACCCAACCG 438 [ 14 ] bla OXA-51 OXA-51_F OXA-51_R TAATGCTTTGATCGGCCTTG TGGAATTGCACTTCATCTTGG 353 [ 14 ] Rep-PCR Rep-PCR_F Rep-PCR_R IIIGCGCCGICATCAGGC ACGTCTTATCAGGCCTAC [ 15 ] Molecular detection of mcr-1 in K

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors:
Zahra Meshkat
,
Himen Salimizand
,
Yousef Amini
,
Davood Mansury
,
Abolfazl Rafati Zomorodi
,
Zoleikha Avestan
,
Azad Jamee
,
Jamal Falahi
,
Hadi Farsiani
, and
Azizollah Mojahed

relatedness To find out the clonal relationship among different isolates, Repetitive Extragenic Palindromic PCR (REP-PCR), International Clonal (IC) Lineage by Multiplex PCR and Multi-Locus Sequence Typing (MLST) (Pasteur scheme) were performed. REP-PCR was

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors:
Hedayat Bozorgi Mohajer
,
Himen Salimizand
,
Dahieh Gharanizadeh
,
Afra Hossainpanahi
, and
Rashid Ramazanzadeh

-48 as described previously [ 10 ]. 2.5 Molecular typing Two methods were used to find the genetic relationship of isolates. Repetitive-palindromic extragenic element polymerase chain reaction (REP-PCR) was done using the REP1 and REP2 primers [ 11

Restricted access
Acta Microbiologica et Immunologica Hungarica
Authors:
Seyda Cengiz
,
Sitkican Okur
,
Cihan Oz
,
Ferda Turgut
,
Burak Gumurcinler
,
Nur Selcen Sevuk
,
Ayse Ilgin Kekec
,
Haluk Cepoglu
,
Umit Sevimli
, and
Mehmet Cemal Adiguzel

. 2.5 Repetitive sequence-based PCR (rep-PCR) fingerprinting The rep-PCR fingerprinting was performed as described previously [ 25 ]. Totally, 2 µL template DNA and 23 µL of PCR master mix including a PCR master mix (Thermo Scientific), (GTG) 5 primer

Restricted access

In recent years, there has been a rapid dissemination of carbapenem resistant Enterobacteriaceae (CRE). This study aimed to compare phenotypic and molecular methods for detection and characterization of CRE isolates at a large tertiary care hospital in Saudi Arabia. This study was carried out between January 2011 and November 2013 at the King Khalid University Hospital (KKUH) in Saudi Arabia. Determination of presence of extended-spectrum beta-lactamases (ESBL) and carbapenem resistance was in accordance with Clinical and Laboratory Standards Institute (CLSI) guidelines. Phenotypic classification was done by the MASTDISCSTM ID inhibitor combination disk method. Genotypic characterization of ESBL and carbapenemase genes was performed by the Check-MDR CT102. Diversilab rep-PCR was used for the determination of clonal relationship. Of the 883 ESBL-positive Enterobacteriaceae detected during the study period, 14 (1.6%) isolates were carbapenem resistant. Both the molecular genotypic characterization and phenotypic testing were in agreement in the detection of all 8 metalo-beta-lactamases (MBL) producing isolates. Of these 8 MBL-producers, 5 were positive for bla NDM gene and 3 were positive for bla VIM gene. Molecular method identified additional bla OXA gene isolates while MASTDISCSTM ID detected one AmpC producer isolate. Both methods agreed in identifying 2 carbapenem resistant isolates which were negative for carbapenemase genes. Diversilab rep-PCR analysis of the 9 Klebsiella pneumoniae isolates revealed polyclonal distribution into eight clusters. MASTDISCSTM ID is a reliable simple cheap phenotypic method for detection of majority of carbapenemase genes with the exception of the bla OXA gene. We recommend to use such method in the clinical laboratory.

Restricted access
Acta Alimentaria
Authors:
Š. Tůma
,
F. Vogensen
,
M. Plocková
, and
J. Chumchalová

The antifungal activity of 322 lactobacilli strains isolated from Edam cheese at different stages of the ripening process was tested against Fusarium proliferatum M 5689 using a dual overlay spot assay. Approximately 21% of the isolates showed a certain level of inhibitory activity.Seven strains with the strongest antifungal activity were examined by the milk agar plate method with three different mould strains isolated from spoiled dairy products as target microorganisms and were compared with the antifungal effectiveness of standard antifungal strains Lactobacillus rhamnosus VT1 and Lb. plantarum DC 1246.The newly isolated lactobacilli strains exhibited the strongest inhibition against F. proliferatum M 5689, followed by Penicillium sp. DMF 0006 and Aspergillus niger DMF 0801. The level of mould growth inhibition of several new isolates, namely Lb. paracasei ST 68, Lb. fermentum ST 40 and Lb. fermentum ST 41, was comparable to or slightly higher than that of standard strains. By use of both phenotypic and genotypic methods (REP-PCR, 16S rDNA), four out of seven antifungally active isolates were identified, one as Lb. paracasei and three as Lb. fermentum. Lb. paracasei ST 68 was chosen for further testing as antifungal protective adjunct for Edam cheese production.

Restricted access

, (1999–2001) Sikora S. — Redžepović S. 2003. Genotypic characterization of indigenous soybean rhizobia by PCR-RFLP of 16S rDNA, rep-PCR, rep-PCR and RAPD analysis. Food Technology and Biotechnology vol. 41 no. 1 61

Restricted access