View More View Less
  • 1 University of Veterinary Medicine and Pharmacy in Košice, Komenského 73, 041 81, Košice, Slovak Republic
  • | 2 University of Prešov in Prešov, Prešov, Slovak Republic
Open access

Abstract

Anaplasma phagocytophilum is the causative agent of granulocytic anaplasmosis. It affects humans and several wild and domesticated mammals, including horses. The aim of our study was a preliminary survey of the occurrence of these re-emerging pathogens in horses in Slovakia. The sera from 200 animals of different ages and both sexes were tested for the presence of A. phagocytophilum antibodies by indirect immunofluorescence assay. Subsequently, detection of the 16S rRNA gene fragment of A. phagocytophilum was attempted by polymerase chain reaction (PCR) in each blood sample. Our results confirmed the presence of specific antibodies in 85 out of 200 individuals (42.5%), but no significant changes were found between the animals of different ages and sexes. However, the PCR analysis did not detect any positive animals. Our data represent one of the highest values of seropositivity to A. phagocytophilum in horses in Central Europe. These results may contribute to a better understanding of the circulation of A. phagocytophilum in this region, thus indicating a potential risk to other susceptible species.

Abstract

Anaplasma phagocytophilum is the causative agent of granulocytic anaplasmosis. It affects humans and several wild and domesticated mammals, including horses. The aim of our study was a preliminary survey of the occurrence of these re-emerging pathogens in horses in Slovakia. The sera from 200 animals of different ages and both sexes were tested for the presence of A. phagocytophilum antibodies by indirect immunofluorescence assay. Subsequently, detection of the 16S rRNA gene fragment of A. phagocytophilum was attempted by polymerase chain reaction (PCR) in each blood sample. Our results confirmed the presence of specific antibodies in 85 out of 200 individuals (42.5%), but no significant changes were found between the animals of different ages and sexes. However, the PCR analysis did not detect any positive animals. Our data represent one of the highest values of seropositivity to A. phagocytophilum in horses in Central Europe. These results may contribute to a better understanding of the circulation of A. phagocytophilum in this region, thus indicating a potential risk to other susceptible species.

Introduction

As a result of the climatic and urban changes in the environment, tick-borne diseases are becoming an emerging problem in the temperate regions of Europe (Parham et al., 2015; Yang et al., 2018). Anaplasma (A.) spp. are one of the important bacterial pathogens transmitted by ticks. In Europe, Ixodes ricinus (Kiewra et al., 2014; Tomassone et al., 2018) was described as the main vector of this pathogen. Worldwide, other tick representatives of the genus Ixodes as well as the genera Dermacentor, Rhipicephalus, Amblyomma and Haemaphysalis play a key role in the transmission of anaplasmosis (Rymaszewska and Grenda, 2008). Until now, there are several known species of bacteria from the genus Anaplasma, such as A. phagocytophilum, A. marginale, A. bovis, A. platys, A. ovis, A. centrale, A. caudatum, A. odocoilei as well as the newly discovered A. capra (Tate et al., 2013; Yang et al., 2015; Dantas-Torres and Otranto, 2017; Mullen and Durden, 2018). Furthermore, a few strains were newly detected and named as ‘Candidatus Anaplasma boleense’, ‘Candidatus Anaplasma camelii’, ‘Candidatus Anaplasma corsicanum’, ‘Candidatus Anaplasma ivorensis’, ‘Candidatus Anaplasma mediterraneum’, ‘Candidatus Anaplasma rodmosense’, and ‘Candidatus Anaplasma sphenisci’ (Bastos et al., 2015; Ehounoud et al., 2016; Guo et al., 2016; Dahmani et al., 2017; Lu et al., 2017; Vanstreels et al., 2018). The zoonotic potential of the most important species A. phagocytophilum and A. capra may represent a risk for public health in Europe (Greene, 2012). Until now, only A. phagocytophilum has been detected in horses. This agent invades the granulocytes of various mammalian species and is the causative agent of the tick-borne fever in ruminants, horses, dogs and humans, known as granulocytic anaplasmosis (Lotrič-Furlan et al., 2006; Passamonti et al., 2010; Król et al., 2016). The disease is characterised by high fever, depression, anorexia, icterus, ataxia, lower limb oedema, thrombocytopenia, anaemia and leukopenia in both naturally and experimentally infected horses (Bermann et al., 2002; Franzén et al., 2005). The acute infection is typical in horses, humans and mice models, while persistent infections occur in sheep, rodents and dogs (Rejmanek et al., 2012).

After reorganisation in the order Rickettsiales based on 16S rRNA and GroESL gene analysis, the species A. phagocytophilum substituted the species Ehrlichia (E.) phagocytophila, E. equi and the agent of canine and human granulocytic ehrlichiosis (Dumler et al., 2001; Woldehiwet, 2010; Pishmisheva et al., 2016). A. phagocytophilum is the most prevalent species of the genus in various parts of the world depending on tick occurrence (Eisen, 2018). It was also described in animals and humans in many countries of Europe (Jahfari et al., 2014). Some studies observed co-exposure to A. phagocytophilum with other serious zoonotic pathogens, especially Borrelia burgdorferi (Derdáková et al., 2011; Butler et al., 2016; Tsachev et al., 2018).

In Slovakia, specific A. phagocytophilum antibodies were detected in humans for the first time by Kalinová et al. (2009). The first clinical case of human granulocytic anaplasmosis was described by Nováková et al. (2010) in a 54-year-old man; subsequently, Kalinová et al. (2015) confirmed specific antibodies to A. phagocytophilum in 22 patients with suspected tick-borne encephalitis. However, the presence of A. phagocytophilum has been reported in Slovakia in 8.3% of ticks (Derdáková et al., 2003) and 3.9% of sheep (Derdáková et al., 2011). Also, Smetanová et al. (2006) observed A. phagocytophilum in 4.4% of ticks, 5.5% of wild boars, 1/2 of roe deer, 1/3 of red deer and in 6% of rodents tested. Later on, Svitálková et al. (2015) demonstrated a higher rate of A. phagocytophilum infection in I. ricinus in an urban habitat in south-western Slovakia. The authors also suggested that rodents are not the main reservoirs of this pathogen.

Until now, only little information has been available regarding the prevalence of A. phagocytophilum in horses. For example, Slivinska et al. (2016) tested 39 horses from Slovakia by PCR and observed only one positive case. Since the infection is characterised by short-term bacteraemia (Passamonti et al., 2010), the detection of specific antibodies facilitates an understanding of the disease circulation.

The aim of this study was to determine and follow up the seroprevalence of A. phagocytophilum and to perform the molecular identification of this agent in horses in Slovakia.

Materials and methods

Ethics statement

The study was performed in compliance with the institutional guidelines for animal welfare issued by The Ethics Committee of the University of Veterinary Medicine and Pharmacy in Košice. All animal samples in this study were examined with the assistance of their owners. Blood samples were collected by a veterinarian.

Blood sampling

Ten-ml samples of venous blood were collected from the jugular vein of 200 horses without clinical signs consistent with equine granulocytic anaplasmosis at the time of sampling. The blood was collected into sterile coagulant-free tubes that facilitated coagulation and into sterile tubes with an anticoagulant. The coagulated blood was centrifuged and the obtained sera and unclotted blood were stored at –80 °C for further tests. The horses included in this study were of both sexes (108 females and 92 males), 22 different breeds and their age ranged from a 10 days old foal to a 26 years old mare. The horses originated from 17 studs (Table 1).

Table 1.

Characterisation of the horse studs

Stud numberDistrictLocationAltitude above sea levelSeasonManagement method
1Trenčín48°58′1.27″N

18°07′8.11″E
226 mSpringday pasture
2Trenčín48°48′59.99″N

17°47′59.99″E
254 mSummerday pasture
3Rožňava48°49′14.63″N

20°22′11.57″E
456 mSummerday/night pasture
4Trenčín48°58′59.99″N

18°08′60.00″E
230 mAutumnday pasture
5Košice – okolie48°35′59.99″N

21°20′59.99″E
181 mAutumnday/night pasture
6Zlaté Moravce48°25′09.8″N

18°24′49.1″E
206 mAutumnhours outing
7Košice48°43′21.8″N 21°13′25.9″E297 mAutumnday pasture
8Brezno48°39′59.99″N

19°38′59.99″E
900 mAutumnday/night pasture
9Lučenec48°19′56.96″N

19°40′1.49″E
187 mSummerday pasture
10Liptovský Mikuláš49°07′60.00″N

19°30′59.99″E
574 mSummerday/night pasture
11Liptovský Mikuláš49°05′52.91″N 19°36′20.09″E577 mSummerday pasture
12Ružomberok49°04′29.28″N

19°18′27.04″E
481 mSummerhours outing
13Liptovský Mikuláš49°05′21.3″N 19°39′00.6″E624 mSummerday/night pasture
14Košice – okolie48°36′51.41″N

20°59′58.45″E
209 mSummerday pasture
15Košice48°39′54.6″N 21°12′22.9″E273 mSummerday pasture
16Nitra48°19′60.00″N

18°12′60.00″E
200 mSummerday pasture
17Levoča49°00′60.00″N

20°45′59.99″E
463 mAutumnday pasture

Characterisation of the sampling sites

The horse studs were selected from various regions of Slovakia (Fig. 1). A large portion of Slovakia is part of the Carpathian Mountains region (Kozak et al., 2013). The average annual temperature in Slovakia is 10 °C, while during the summer the average temperature increases to 26 °C. In association with an annual average relative humidity of 60% and rainfall varying from 500 to 2000 mm (Onderka et al., 2020), the whole territory of Slovakia represents a very suitable biotope for tick occurrence (Bazovska et al., 2005).

Fig. 1.
Fig. 1.

Locations of the sampling sites. 1–17: numbers of horse studs

Citation: Acta Veterinaria Hungarica 69, 1; 10.1556/004.2021.00007

Serological analysis

The sera were tested for IgG against A. phagocytophilum using the commercial A. phagocytophilum IFA Equine Antibody Kit (Fuller Laboratories, USA) based on A. phagocytophilum HE-1 isolate antigens derived from HL-60 cells. The test was performed according to the manufacturer's instructions. Briefly, all samples were tested at a titre of 1:80 as a starting dilution in phosphate-buffered saline solution (PBS) of pH 7.2. The samples giving a positive reaction at a titre of 1:80 were tested also at 1:160, 1:320 and 1:640. The diluted sera were placed onto the slides with A. phagocytophilum antigen and incubated for 30 min at 37 °C in a humid chamber. After washing with PBS, anti-horse IgG conjugate was added and the slides were incubated under the same conditions. After the final wash, the PBS samples were mounted to buffered glycerol. The results were analysed using a NIKON Labophot 2A fluorescence microscope at ×400 magnification. The reaction was scored positive when A. phagocytophilum morulae giving bright green fluorescence were shown, indicating the presence of specific antibodies. Samples giving a positive reaction at 1:640 were considered positive.

PCR analysis

The molecular detection of A. phagocytophilum was attempted, based on an 839-bp fragment of the 16S rRNA gene, using specific primers designed in the Primer3plus software (F: 5′GCATGTAGGCGGTTCGGTAAGTT3′ and R: 5′ATGGCGTGACGGGCAGTGT3′). The PCR reaction was performed in a total volume of 50 µL of the reaction mixture containing 2 µL of the tested DNA, 1.2 µL of primers, 5.5 µL of the PCR Master Mix (Jena Bioscience, Germany), 0.2 µL of the Taq Polymerase (Jena Bioscience, Germany) and 41.5 µL of the PCR Ultra H2O (Top Bio, Prague, Czech Republic). In each PCR assay, positive and negative controls were used. The PCR protocol consisted of the following steps: initial DNA denaturation for 2 min at 94 °C followed by the next 30 cycles, each consisting of denaturation at 94 °C for 30 s, annealing at 51.2 °C for 30 s and extension at 72 °C for 1 min, ending with a final extension at 72 °C for 10 min and the subsequent rapid cooling to 4 °C. The PCR product was visualised on 1% agarose gel with Sybr Gold (Thermo Fisher Scientific, Waltham, MA, USA).

Statistical analysis

All statistical analyses were performed in the statistical analysis software GraphPad Prism, version 5.01 (GraphPad Software, Inc., San Diego, California, USA). The statistical comparison of categorical variables was carried out with the chi-square (χ2) test or the Fisher's exact test, and P values of less than 0.05 were considered significant. The differences in prevalence observed for individual sex and age categories of mares, stallions and geldings, respectively, were tested by the chi-square (χ2) test.

Results

Our results (Table 2) confirmed the presence of specific antibodies to A. phagocytophilum in 85 out of the 200 horses tested (42.5%). The seropositivity rates identified in individual studs varied from 15.4% to 83.3%. The differences between studs in antibody prevalence were not statistically significant (χ2 = 17.40, df = 16, P = 0.360).

Table 2.

Results of screening for anti-Anaplasma phagocytophilum IgG antibodies by the indirect immunofluorescence assay in horses from selected regions in Slovakia

Stud numberNumber of horses testedFinally negative titre ≤1:320Tested titreFinally positive titre ≥1:640
1:80
1:160
1:320
Number%Positive/total animalsPositive/1:80 positivePositive/1:80 positiveNumber%
1151066.77/157/75/7533.3
210550.06/105/65/6550.0
3201155.013/2010/1310/13945.0
412866.74/124/44/4433.3
513969.27/135/75/7430.8
6191473.79/197/95/9526.3
710660.05/105/54/5440.0
8201050.015/2015/1512/151050.0
95360.02/52/22/2240.0
106116.75/65/55/5583.3
1111545.58/116/86/8654.5
12131184.63/133/33/3215.4
134250.03/42/32/3250.0
149666.77/94/73/7333.3
1521838.116/2113/1613/161361.9
167457.15/75/53/5342.9
175240.03/53/33/3360.0
Total20011557.5118/200101/11890/1188542.5

The results of serological analyses by sex and age are shown in Table 3.

Table 3.

Results of the serological analysis by sex and agea

SexIFA, totalIFA by age category
NegativePositive<3 years≥3 < 10 years≥10 years
NegativePositiveNegativePositiveNegativePositive
Mares62464223133531
Stallions1210237235
Geldings4129011382820
Total115856643236656

PCR-positive samples were not found at all; IFA = indirect immunofluorescence assay.

In our study, specific antibodies were observed in 46/108 mares, 10/22 stallions and 29/70 geldings. The comparison of seroprevalence in animals by sex did not show significant differences (χ2 = 0.1128, df = 2, P = 0.946). The comparison of seroprevalence in individual age categories relative to sex did not show significant differences either. However, different results were obtained in the various age categories. In the category of less than three years, the sample size was too small to evaluate the chi-square test; for 3–10 years old animals, an insignificant difference, i.e. less than 0.05 (χ2 = 0.755, df = 2, P = 0.686), was demonstrated. For the age category of more than 10 years, an insignificant prevalence, i.e. a P value higher than 0.05 (χ2 = 1.265, df = 2, P = 0.531), was detected as well.

No positive PCR result was obtained at all.

Discussion

In this paper we present the first multiregional study focused on the seroprevalence of A. phagocytophilum in the horse population of Slovakia. We confirmed a 42.5% prevalence of antibodies to A. phagocytophilum. Consistently with the results obtained by Rolim et al. (2015), no predisposition for infection based on the animal's sex or age was observed in our study, and no molecular evidence of A. phagocytophilum was found in the animals tested.

In Europe, a seropositivity higher than this was observed only in the Czech Republic (Praskova et al., 2011). In other European countries, seropositivity to A. phagocytophilum in horses has ranged between 16.7 and 22.75% until now (Egenvall et al., 2001; Leblond et al., 2005; Hansen et al., 2010; Passamonti et al., 2010; Ebani, 2019; Tsachev et al., 2019).

Similarly, different results were observed in Brazil as well. Nogueira et al. (2017) screened 97 blood samples from horses and 11.34% of them were seropositive to A. phagocytophilum. Similar results were presented by Dos Santos et al. (2019), with the seropositivity reaching 17.4%. A higher seropositivity rate (65%) was observed by Salvagni et al. (2010) in Brazilian horses.

In contrast to the previous data, a very low seroprevalence for A. phagocytophilum was detected in horses in Korea – 3.1% (Lee et al., 2015) and in Canada – 0.53% (Schvartz et al., 2015). There may be several reasons for these differences. One of them is the geographical variability of equine granulocytic anaplasmosis dependent on the tick-friendly environment (Janzén et al., 2019). Another reason may be the growing occurrence of this re-emerging disease worldwide. For example, Andersen et al. (2019) observed approximately twice as high A. phagocytophilum prevalence in the roe deer population as compared to the results obtained 14 years previously in Denmark (Skarphédinsson et al., 2005). Furthermore, such variation in the seropositivity levels may be caused by the use of different serological tests or horse management methods (Salvagni et al., 2010).

We suggest that the negative results obtained by molecular detection in this study may have been due the fact that none of the tested clinically healthy horses was in the acute phase of infection (Rejmanek et al., 2012). The acute phase is characterised by limited and short-term bacteraemia, while the peak antibody titre occurs between days 19 and 81 of infection and humoral immunity can persist for at least two years (Van Andel et al., 1998). On the other hand, while applying the PCR method, Passamonti et al. (2010) observed 11 horses positive for A. phagocytophilum in a group of 120 animals without any clinical signs, and none of the horses showed clinical or haematological changes typical of this disease. This can be regarded as one of the reasons why clinical anaplasmosis is still underdiagnosed.

The positive results of our serological analysis prove the circulation of A. phagocytophilum in Slovakian horses. Although it seems unlikely for the infected horses to serve as effective reservoirs of A. phagocytophilum (Sellon and Long, 2014), the infection was found to persist in experimentally infected horses for at least 129 days. Our data contribute to a better understanding of the potential occurrence and spread of this disease and facilitate the identification of new sites with a higher risk of A. phagocytophilum infection.

Anaplasmosis is an re-emerging zoonotic disease with a natural cycle. Due to the non-specific clinical signs and/or the frequently subclinical course of anaplasmosis in both animals and humans, it is important to include this disease in the differential diagnosis of vector-borne encephalitis for animals as well as humans. The results of this serological survey indicate that anaplasmosis can be common in horses. In view of the One Health concept, the results can significantly contribute to improving the knowledge of the epidemiological situation and serve as a basis for successful diagnosis and risk assessment in this region of Central Europe.

Acknowledgements

This work was supported by IGA UVLF 04/2018 and by the Ministry of Education, Science, Research and Sport of the Slovak Republic through the project KEGA 014UVLF-4/2019.

References

  • Andersen, N. S., Larsen, S. L., Olesen, C. R., Stiasny, K., Kolmos, H. J., Jensen, P. M. and Skarphédinsson, S. (2019): Continued expansion of tick-borne pathogens: tick-borne encephalitis virus complex and Anaplasma phagocytophilum in Denmark. Ticks Tick Borne Dis. 10 ,115123.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bastos, A. D. S., Mohammed, O. B., Bennett, N. C., Petevinos, C. and Alagaili, A. N. (2015): Molecular detection of novel Anaplasmataceae closely related to Anaplasma platys and Ehrlichia canis in the dromedary camel (Camelus dromedarius). Vet. Microbiol. 179 ,310314.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bazovska, S., Machacova, E., Spalekova, M. and Kontrosova, S. (2005): Reported incidence of Lyme disease in Slovakia and antibodies to B. burgdorferi antigens detected in healthy population. Bratisl. Lek. Listy 106 ,270273.

    • Search Google Scholar
    • Export Citation
  • Bermann, F., Davoust, B., Fournier, P. E., Brisou-Lapointe, A. V. and Brouqui, P. (2002): Ehrlichia equi (Anaplasma phagocytophila) infection in an adult horse in France. Vet. Rec. 150 ,787788.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Butler, C. M., Sloet van Oldruitenborgh-Oosterbaan, M. M., Werners, A. H., Stout, T. A. E., Nielen, M., Jongejan, F., van der Kolk, J. H. and Houwers, D. J. (2016): Borrelia burgdorferi and Anaplasma phagocytophilum in ticks and their equine hosts: A prospective clinical and diagnostic study of 47 horses following removal of a feeding tick. Pferdeheilkunde 32 ,335345.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dahmani, M., Davoust, B., Tahir, D., Raoult, D., Fenollar, F. and Mediannikov, O. (2017): Molecular investigation and phylogeny of Anaplasmataceae species infecting domestic animals and ticks in Corsica, France. Parasit. Vectors 10 ,302.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dantas-Torres, F. and Otranto, D. (2017): Anaplasmosis. In: Marcondes, C. B. (ed.) Arthropod Borne Diseases. Springer, Cham. Chapter 15, pp. 215222.

    • Search Google Scholar
    • Export Citation
  • Derdáková, M., Halánová, M., Stanko, M., Štefančíková, A., Čisláková, L. and Peťko, B. (2003): Molecular evidence for Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato in Ixodes ricinus ticks from eastern Slovakia. Ann. Agric. Environ. Med. 10 ,269271.

    • Search Google Scholar
    • Export Citation
  • Derdáková, M., Štefančíková, A., Špitalská, E., Tarageľová, V., Košťálová, T., Hrkľová, G., Kybicová, K., Schánilec, P., Majláthová, V., Várady, M. and Peťko, B. (2011): Emergence and genetic variability of Anaplasma species in small ruminants and ticks from Central Europe. Vet. Microbiol. 153, 293298.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dos Santos, T. M., Roier, E. C. R., Pires, M. S., Santos, H. A., Vilela, J. A. R., Peckle, M., Paulino, P. G., Baldani, C. D. and Massard, C. L. (2019): Molecular evidence of Anaplasma phagocytophilum and Theileria equi coinfections in horses from Rio de Janeiro, Brazil. Vet. Anim. Sci. 7 ,100055.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dumler, J. S., Barbet, A. F., Bekker, C. P., Dasch, G. A., Palmer, G. H., Ray, S. C., Rikihisa, Y. and Rurangirwa, F. R. (2001): Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51 ,21452165.

    • Search Google Scholar
    • Export Citation
  • Ebani, V. V. (2019): Serological evidence of Anaplasma phagocytophilum and spotted fever group Rickettsia spp. exposure in horses from Central Italy. Pathogens 8 ,88.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Egenvall, A., Franzén, P., Gunnarsson A., Engvall, E. O., Vågsholm, I., Wikström, U-B. and Artursson, K. (2001): Cross-sectional study of the seroprevalence to Borrelia burgdorferi sensu lato and granulocytic Ehrlichia spp. and demographic, clinical and tick-exposure factors in Swedish horses. Prev. Vet. Med. 49 ,191208.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Ehounoud, C. B., Yao, K. P., Dahmani, M., Achi, Y. L., Amanzougaghene, N., N'Douba, A. K., N'Guessan, J. D., Raoult, D., Fenollar, F. and Mediannikov, O. (2016): Multiple pathogens including potential new species in tick vectors in Côte d’Ivoire. PLOS Negl. Trop. Dis. 10 ,e0004367.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Eisen, L. (2018): Pathogen transmission in relation to duration of attachment by Ixodes scapularis ticks. Ticks Tick Borne Dis. 9 ,535542.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Franzén, P., Aspan, A., Egenvall, A., Gunnarsson, A., Åberg, L. and Pringle, J. (2005): Acute clinical, hematological, serologic, and polymerase chain reaction findings in horses experimentally infected with a European strain of Anaplasma phagocytophilum. J. Vet. Intern. Med. 19 ,232239.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Greene, C. E. (2012): Infectious Diseases of the Dog and Cat. 4th edition. Elsevier Inc., St. Louis, Mo., 1354 pp.

  • Guo, W-P., Tian, J-H., Lin, X-D., Ni, X-B., Chen, X-P., Liao, Y., Yang, S-Y., Dumler, S., Holmes, E. C. and Zhang, Y-Z. (2016): Extensive genetic diversity of Rickettsiales bacteria in multiple mosquito species. Sci. Rep. 6 ,38770.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Hansen, M. G. B., Christoffersen, M., Thuesen, L. R., Petersen, M. R. and Bojesen, A. M. (2010): Seroprevalence of Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum in Danish horses. Acta Vet. Scand. 52 ,49.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Jahfari, S., Coipan, E. C., Fonvile, M., van Leeuwen, A. D., Hengeveld, P., Heylen, D., Heyman, P., van Maanen, C., Butler, C. M., Földvári, G., Szekeres, S., van Duijvendijk, G., Tack, W., Rijks, J. M., van der Giessen, J., Takken, W., van Wieren, S. E., Takumi, K. and Sprong, H. (2014): Circulation of four Anaplasma phagocytophilum ecotypes in Europe. Parasit. Vectors 7 ,365.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Janzén, T., Petersson, M., Hammer, M., Aspán, A. and Dinnétz, P. (2019): Equine granulocytic anaplasmosis in Southern Sweden: Associations with coniferous forest, water bodies and landscape heterogeneity. Agric. Ecosyst. Environ. 285 ,106626.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kalinová, Z., Halánová, M., Čisláková, L., Juriš, P. and Čechová, L. (2015): Occurrence of antibodies to Anaplasma phagocytophilum in patients with suspected tick-borne encephalitis. Ann. Agric. Environ. Med. 22 ,409411.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kalinová, Z., Halánová, M., Čisláková, L., Sulinová, Z. and Jarčuška, P. (2009): Occurrence of IgG antibodies to Anaplasma phagocytophilum in humans suspected of Lyme borreliosis in eastern Slovakia. Ann. Agric. Environ. Med. 16 ,285288.

    • Search Google Scholar
    • Export Citation
  • Kiewra, D., Zaleśny, G. and Czułowska, A. (2014): The prevalence of Anaplasma phagocytophilum in questing Ixodes ricinus ticks in SW Poland. Pol. J. Microbiol. 63 ,8993.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kozak, J., Ostapowicz, K., Bytnerowicz, A. and Wyzga, B. (2013): The Carpathians: Integrating Nature and Society Towards Sustainability. Springer, Berlin, Germany. 653 pp.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Król, N., Obiegala, A., Pfeffer, M., Lonc, E. and Kiewra, D. (2016): Detection of selected pathogens in ticks collected from cats and dogs in the Wrocław Agglomeration, South-West Poland. Parasit. Vectors 9 ,351.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Leblond, A., Pradier, S., Ptel, P. H., Fortier, G., Boireau, P., Chadoeuf, J. and Sabatier, P. (2005): Epidemiological investigations on equine anaplasmosis (Anaplasma phagocytophilum) in South France [in French]. Rev. Sci. Tech. 24 ,899908.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lee, S. H., Kim, K. T., Yun, S. H., Choi, E., Lee, G. H., Park, Y. S., Cho, K. H., Yi, S., Kwon, O. D., Kim, T. H. and Kwak, D. (2015): Serological and molecular detection of Anaplasma phagocytophilum in horses reared in Korea. Vet. Med. 60 ,533538.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lotrič-Furlan, S., Rojko, T., Petrovec, M., Avšič-Županc, T. and Strle, F. (2006): Epidemiological, clinical and laboratory characteristics of patients with human granulocytic anaplasmosis in Slovenia. Wien Klin. Wochenschr. 118 ,708713.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lu, M., Tian, J-H., Yu, B., Guo, W-P., Holmes, E. C. and Zhang, Y-Z. (2017): Extensive diversity of Rickettsiales bacteria in ticks from Wuhan, China. Ticks Tick Borne Dis. 8 ,574580.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Mullen, G. R. and Durden, L. A. (2018): Medical and Veterinary Entomology. 3rd edition. Elsevier Inc., London. 769 pp.

  • Nogueira, R. M. S., Silva, A. B., Sato, T. P., de Sá, J. C., dos Santos, A. C. G., Filho, E. F. A., do Vale, T. L. and Gazêta, G. S. (2017): Molecular and serological detection of Theileria equi, Babesia caballi and Anaplasma phagocytophilum in horses and ticks in Maranhão, Brazil. Pesq. Vet. Bras. 37 ,14161422.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Nováková, M., Víchová, B., Majláthová, V., Lesňáková, A., Pochybová, M. and Peťko, B. (2010): First case of human granulocytic anaplasmosis from Slovakia. Ann. Agric. Environ. Med. 17 ,173175.

    • Search Google Scholar
    • Export Citation
  • Onderka, M., Pecho, J. and Nejedlík, P. (2020): On how rainfall characteristics affect the sizing of rain barrels in Slovakia. J. Hydrol. Reg. Stud. 32 ,100747.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Parham, P. E., Waldock, J., Christophides, G. K., Hemming, D., Agusto, F., Evans, K. J., Fefferman, N., Gaff, H., Gumel, A., LaDeau, S., Lenhart, S., Mickens, R. E., Naumova, E. N., Ostfeld, R. S., Ready, P. D., Thomas, M. B., Velasco-Hernandez, J. and Michael, E. (2015): Climate, environmental and socio-economic change: weighing up the balance in vector-borne disease transmission. Philos. Trans. R. Soc. Lond. B Biol. Sci. 370 ,117.

    • Search Google Scholar
    • Export Citation
  • Passamonti, F., Veronesi, F., Cappelli, K., Capomaccio, S., Coppola, G., Marenzoni, M. L., Piergili, F. D., Verini, S. A. and Coletti, M. (2010): Anaplasma phagocytophilum in horses and ticks: A preliminary survey in Central Italy. Comp. Immunol. Microbiol. Infect. Dis. 33 ,7883.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Pishmisheva, M., Baymakova, M., Tsachev, I. and Christova, I. (2016): Ehrlichioses and anaplasmoses. Gen. Med. 18 ,6672.

  • Praskova, I., Bezdekova, B., Zeman, P. and Jahn, P. (2011): Seroprevalence of Anaplasma phagocytophilum in horses in the Czech Republic. Ticks Tick Borne Dis. 2, 111115.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rejmanek, D., Foley, P., Barbet, A. and Foley, J. (2012): Evolution of antigen variation in the tick-borne pathogen Anaplasma phagocytophilum. Mol. Biol. Evol. 29 ,391400.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rolim, M. F., Oliveira, F. C. R., Graca, F. A. S. and Brasil, F. C. (2015): Serological evidence of exposure to Anaplasma phagocytophilum in horses from the Rio de Janeiro state mounted police bred in the urban zone. Ciên. Anim. Bras. 16 ,377387.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rymaszewska, A. and Grenda, S. (2008): Bacteria of the genus Anaplasma – characteristics of Anaplasma and their vectors: a review. Vet. Med. 53 ,573584.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Salvagni, C. A., Dagnone, A. S., Gomes, T. S., Mota, J. S., Andrade, G. M., Baldani, C. D. and Machado, R. Z. (2010): Serologic evidence of equine granulocytic anaplasmosis in horses from central West Brazil. Rev. Bras. Parasitol. Vet. Jaboticabal 19 ,135140.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Schvartz, G., Epp, T., Burgess, H. J., Chilton, N. B., Pearl, D. L. and Lohmann, K. L. (2015): Seroprevalence of equine granulocytic anaplasmosis and Lyme borreliosis in Canada as determined by a point-of care enzyme-linked immunosorbent assay (ELISA). Can. Vet. J. 56 ,575580.

    • Search Google Scholar
    • Export Citation
  • Sellon, D. C. and Long, M. T. (2014): Anaplasma phagocytophilum infection. In: Sellon, D. C. and Long, M. T. (eds) Equine Infectious Diseases. 2nd edition. Saunders/Elsevier, St. Louis, Missouri. pp. 344347.

    • Search Google Scholar
    • Export Citation
  • Skarphédinsson, S., Jensen, P. M. and Kristiansen, K. (2005): Survey of tick-borne infections in Denmark. Emerg. Infect. Dis. 11 ,10551061.

  • Slivinska, K., Víchova, B., Werszko, J., Szewczyk, T., Wróblewski, Z., Peťko, B., Ragač, O., Demeshkant, V. and Karbowiak, G. (2016): Molecular surveillance of Theileria equi and Anaplasma phagocytophilum infections in horses from Ukraine, Poland and Slovakia. Vet. Parasitol. 215 ,3537.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Smetanová, K., Schwarzová, K. and Kocianová, E. (2006): Detection of Anaplasma phagocytophilum, Coxiella burnetti, Rickettsia spp., and Borrelia burgdorferi s. l. in ticks, and wild-living animals in Western and Middle Slovakia. Ann. N. Y. Acad. Sci. 1078 ,312315.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Svitálková, Z., Haruštiaková, D., Mahríková, L., Berthová, L., Slovák, M., Kocianová, E. and Kazimírová, M. (2015): Anaplasma phagocytophilum prevalence in ticks and rodents in an urban and natural habitat in South-Western Slovakia. Parasit. Vectors 8 ,276.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tate, C. M., Howerth, E. W., Mead, D. G., Dugan, V. G., Luttrell, P. M., Sahora, A. I., Munderloh, U. G., Davidson, W. R. and Yabsley, M. J. (2013): Anaplasma odocoilei sp. nov. (family Anaplasmataceae) from white-tailed deer (Odocoileus virginianus). Ticks Tick Borne Dis. 4 ,110119.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tomassone, L., Berriatua, E., De Sousa, R., Duscher, G. G., Mihalca, A. D., Silaghi, C., Sprong, H. and Zintl, A. (2018): Neglected vector-borne zoonoses in Europe: Into the wild. Vet. Parasitol. 251 ,1726.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tsachev, I., Baymakova, M. and Pantchev, N. (2019): Seroprevalence of Anaplasma phagocytophilum, Ehrlichia spp. and Borrelia burgdorferi infections in horses: first report from Northern Bulgaria – Short communication. Acta Vet. Hung. 67 ,197203.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tsachev, I., Pantchev, N., Marutsov, P., Petrov, V., Gundasheva, D. and Baymakova, M. (2018): Serological evidence of Borrelia burgdorferi, Anaplasma phagocytophilum and Ehrlichia spp. infections in horses from Southeastern Bulgaria. Vector Borne Zoonotic Dis. 18 ,588594.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Van Andel, A. E., Maganrelli, L. A., Heimer, R. and Wilson, M. L. (1998): Development and duration of antibody response against Ehrlichia equi in horses. J. Am. Vet. Med. Assoc. 212 ,19101914.

    • Search Google Scholar
    • Export Citation
  • Vanstreels, R. E. T., Yabsley, M. J., Parsons, N. J., Swanepoel, L. and Pistorius, P. A. (2018): A novel candidate species of Anaplasma that infects avian erythrocytes. Parasit. Vectors 11 ,525.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Woldehiwet, Z. (2010): The natural history of Anaplasma phagocytophilum. Vet. Parasitol. 167 ,108122.

  • Yang, J., Han, R., Niu, Q., Liu, Z., Guan, G., Liu, G., Luo, J. and Yin, H. (2018): Occurrence of four Anaplasma species with veterinary and public health significance in sheep, northwestern China. Ticks Tick Borne Dis. 9 ,8285.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Yang, J., Li, Y., Liu, Z., Liu, J., Niu, Q., Ren, Q., Chen, Z., Guan, G., Luo, J. and Yin, H. (2015): Molecular detection and characterisation of Anaplasma spp. in sheep and cattle from Xinjiang, northwest China. Parasit. Vectors 8 ,108.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Andersen, N. S., Larsen, S. L., Olesen, C. R., Stiasny, K., Kolmos, H. J., Jensen, P. M. and Skarphédinsson, S. (2019): Continued expansion of tick-borne pathogens: tick-borne encephalitis virus complex and Anaplasma phagocytophilum in Denmark. Ticks Tick Borne Dis. 10 ,115123.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bastos, A. D. S., Mohammed, O. B., Bennett, N. C., Petevinos, C. and Alagaili, A. N. (2015): Molecular detection of novel Anaplasmataceae closely related to Anaplasma platys and Ehrlichia canis in the dromedary camel (Camelus dromedarius). Vet. Microbiol. 179 ,310314.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Bazovska, S., Machacova, E., Spalekova, M. and Kontrosova, S. (2005): Reported incidence of Lyme disease in Slovakia and antibodies to B. burgdorferi antigens detected in healthy population. Bratisl. Lek. Listy 106 ,270273.

    • Search Google Scholar
    • Export Citation
  • Bermann, F., Davoust, B., Fournier, P. E., Brisou-Lapointe, A. V. and Brouqui, P. (2002): Ehrlichia equi (Anaplasma phagocytophila) infection in an adult horse in France. Vet. Rec. 150 ,787788.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Butler, C. M., Sloet van Oldruitenborgh-Oosterbaan, M. M., Werners, A. H., Stout, T. A. E., Nielen, M., Jongejan, F., van der Kolk, J. H. and Houwers, D. J. (2016): Borrelia burgdorferi and Anaplasma phagocytophilum in ticks and their equine hosts: A prospective clinical and diagnostic study of 47 horses following removal of a feeding tick. Pferdeheilkunde 32 ,335345.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dahmani, M., Davoust, B., Tahir, D., Raoult, D., Fenollar, F. and Mediannikov, O. (2017): Molecular investigation and phylogeny of Anaplasmataceae species infecting domestic animals and ticks in Corsica, France. Parasit. Vectors 10 ,302.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dantas-Torres, F. and Otranto, D. (2017): Anaplasmosis. In: Marcondes, C. B. (ed.) Arthropod Borne Diseases. Springer, Cham. Chapter 15, pp. 215222.

    • Search Google Scholar
    • Export Citation
  • Derdáková, M., Halánová, M., Stanko, M., Štefančíková, A., Čisláková, L. and Peťko, B. (2003): Molecular evidence for Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato in Ixodes ricinus ticks from eastern Slovakia. Ann. Agric. Environ. Med. 10 ,269271.

    • Search Google Scholar
    • Export Citation
  • Derdáková, M., Štefančíková, A., Špitalská, E., Tarageľová, V., Košťálová, T., Hrkľová, G., Kybicová, K., Schánilec, P., Majláthová, V., Várady, M. and Peťko, B. (2011): Emergence and genetic variability of Anaplasma species in small ruminants and ticks from Central Europe. Vet. Microbiol. 153, 293298.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dos Santos, T. M., Roier, E. C. R., Pires, M. S., Santos, H. A., Vilela, J. A. R., Peckle, M., Paulino, P. G., Baldani, C. D. and Massard, C. L. (2019): Molecular evidence of Anaplasma phagocytophilum and Theileria equi coinfections in horses from Rio de Janeiro, Brazil. Vet. Anim. Sci. 7 ,100055.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Dumler, J. S., Barbet, A. F., Bekker, C. P., Dasch, G. A., Palmer, G. H., Ray, S. C., Rikihisa, Y. and Rurangirwa, F. R. (2001): Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51 ,21452165.

    • Search Google Scholar
    • Export Citation
  • Ebani, V. V. (2019): Serological evidence of Anaplasma phagocytophilum and spotted fever group Rickettsia spp. exposure in horses from Central Italy. Pathogens 8 ,88.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Egenvall, A., Franzén, P., Gunnarsson A., Engvall, E. O., Vågsholm, I., Wikström, U-B. and Artursson, K. (2001): Cross-sectional study of the seroprevalence to Borrelia burgdorferi sensu lato and granulocytic Ehrlichia spp. and demographic, clinical and tick-exposure factors in Swedish horses. Prev. Vet. Med. 49 ,191208.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Ehounoud, C. B., Yao, K. P., Dahmani, M., Achi, Y. L., Amanzougaghene, N., N'Douba, A. K., N'Guessan, J. D., Raoult, D., Fenollar, F. and Mediannikov, O. (2016): Multiple pathogens including potential new species in tick vectors in Côte d’Ivoire. PLOS Negl. Trop. Dis. 10 ,e0004367.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Eisen, L. (2018): Pathogen transmission in relation to duration of attachment by Ixodes scapularis ticks. Ticks Tick Borne Dis. 9 ,535542.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Franzén, P., Aspan, A., Egenvall, A., Gunnarsson, A., Åberg, L. and Pringle, J. (2005): Acute clinical, hematological, serologic, and polymerase chain reaction findings in horses experimentally infected with a European strain of Anaplasma phagocytophilum. J. Vet. Intern. Med. 19 ,232239.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Greene, C. E. (2012): Infectious Diseases of the Dog and Cat. 4th edition. Elsevier Inc., St. Louis, Mo., 1354 pp.

  • Guo, W-P., Tian, J-H., Lin, X-D., Ni, X-B., Chen, X-P., Liao, Y., Yang, S-Y., Dumler, S., Holmes, E. C. and Zhang, Y-Z. (2016): Extensive genetic diversity of Rickettsiales bacteria in multiple mosquito species. Sci. Rep. 6 ,38770.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Hansen, M. G. B., Christoffersen, M., Thuesen, L. R., Petersen, M. R. and Bojesen, A. M. (2010): Seroprevalence of Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum in Danish horses. Acta Vet. Scand. 52 ,49.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Jahfari, S., Coipan, E. C., Fonvile, M., van Leeuwen, A. D., Hengeveld, P., Heylen, D., Heyman, P., van Maanen, C., Butler, C. M., Földvári, G., Szekeres, S., van Duijvendijk, G., Tack, W., Rijks, J. M., van der Giessen, J., Takken, W., van Wieren, S. E., Takumi, K. and Sprong, H. (2014): Circulation of four Anaplasma phagocytophilum ecotypes in Europe. Parasit. Vectors 7 ,365.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Janzén, T., Petersson, M., Hammer, M., Aspán, A. and Dinnétz, P. (2019): Equine granulocytic anaplasmosis in Southern Sweden: Associations with coniferous forest, water bodies and landscape heterogeneity. Agric. Ecosyst. Environ. 285 ,106626.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kalinová, Z., Halánová, M., Čisláková, L., Juriš, P. and Čechová, L. (2015): Occurrence of antibodies to Anaplasma phagocytophilum in patients with suspected tick-borne encephalitis. Ann. Agric. Environ. Med. 22 ,409411.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kalinová, Z., Halánová, M., Čisláková, L., Sulinová, Z. and Jarčuška, P. (2009): Occurrence of IgG antibodies to Anaplasma phagocytophilum in humans suspected of Lyme borreliosis in eastern Slovakia. Ann. Agric. Environ. Med. 16 ,285288.

    • Search Google Scholar
    • Export Citation
  • Kiewra, D., Zaleśny, G. and Czułowska, A. (2014): The prevalence of Anaplasma phagocytophilum in questing Ixodes ricinus ticks in SW Poland. Pol. J. Microbiol. 63 ,8993.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kozak, J., Ostapowicz, K., Bytnerowicz, A. and Wyzga, B. (2013): The Carpathians: Integrating Nature and Society Towards Sustainability. Springer, Berlin, Germany. 653 pp.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Król, N., Obiegala, A., Pfeffer, M., Lonc, E. and Kiewra, D. (2016): Detection of selected pathogens in ticks collected from cats and dogs in the Wrocław Agglomeration, South-West Poland. Parasit. Vectors 9 ,351.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Leblond, A., Pradier, S., Ptel, P. H., Fortier, G., Boireau, P., Chadoeuf, J. and Sabatier, P. (2005): Epidemiological investigations on equine anaplasmosis (Anaplasma phagocytophilum) in South France [in French]. Rev. Sci. Tech. 24 ,899908.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lee, S. H., Kim, K. T., Yun, S. H., Choi, E., Lee, G. H., Park, Y. S., Cho, K. H., Yi, S., Kwon, O. D., Kim, T. H. and Kwak, D. (2015): Serological and molecular detection of Anaplasma phagocytophilum in horses reared in Korea. Vet. Med. 60 ,533538.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lotrič-Furlan, S., Rojko, T., Petrovec, M., Avšič-Županc, T. and Strle, F. (2006): Epidemiological, clinical and laboratory characteristics of patients with human granulocytic anaplasmosis in Slovenia. Wien Klin. Wochenschr. 118 ,708713.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Lu, M., Tian, J-H., Yu, B., Guo, W-P., Holmes, E. C. and Zhang, Y-Z. (2017): Extensive diversity of Rickettsiales bacteria in ticks from Wuhan, China. Ticks Tick Borne Dis. 8 ,574580.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Mullen, G. R. and Durden, L. A. (2018): Medical and Veterinary Entomology. 3rd edition. Elsevier Inc., London. 769 pp.

  • Nogueira, R. M. S., Silva, A. B., Sato, T. P., de Sá, J. C., dos Santos, A. C. G., Filho, E. F. A., do Vale, T. L. and Gazêta, G. S. (2017): Molecular and serological detection of Theileria equi, Babesia caballi and Anaplasma phagocytophilum in horses and ticks in Maranhão, Brazil. Pesq. Vet. Bras. 37 ,14161422.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Nováková, M., Víchová, B., Majláthová, V., Lesňáková, A., Pochybová, M. and Peťko, B. (2010): First case of human granulocytic anaplasmosis from Slovakia. Ann. Agric. Environ. Med. 17 ,173175.

    • Search Google Scholar
    • Export Citation
  • Onderka, M., Pecho, J. and Nejedlík, P. (2020): On how rainfall characteristics affect the sizing of rain barrels in Slovakia. J. Hydrol. Reg. Stud. 32 ,100747.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Parham, P. E., Waldock, J., Christophides, G. K., Hemming, D., Agusto, F., Evans, K. J., Fefferman, N., Gaff, H., Gumel, A., LaDeau, S., Lenhart, S., Mickens, R. E., Naumova, E. N., Ostfeld, R. S., Ready, P. D., Thomas, M. B., Velasco-Hernandez, J. and Michael, E. (2015): Climate, environmental and socio-economic change: weighing up the balance in vector-borne disease transmission. Philos. Trans. R. Soc. Lond. B Biol. Sci. 370 ,117.

    • Search Google Scholar
    • Export Citation
  • Passamonti, F., Veronesi, F., Cappelli, K., Capomaccio, S., Coppola, G., Marenzoni, M. L., Piergili, F. D., Verini, S. A. and Coletti, M. (2010): Anaplasma phagocytophilum in horses and ticks: A preliminary survey in Central Italy. Comp. Immunol. Microbiol. Infect. Dis. 33 ,7883.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Pishmisheva, M., Baymakova, M., Tsachev, I. and Christova, I. (2016): Ehrlichioses and anaplasmoses. Gen. Med. 18 ,6672.

  • Praskova, I., Bezdekova, B., Zeman, P. and Jahn, P. (2011): Seroprevalence of Anaplasma phagocytophilum in horses in the Czech Republic. Ticks Tick Borne Dis. 2, 111115.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rejmanek, D., Foley, P., Barbet, A. and Foley, J. (2012): Evolution of antigen variation in the tick-borne pathogen Anaplasma phagocytophilum. Mol. Biol. Evol. 29 ,391400.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rolim, M. F., Oliveira, F. C. R., Graca, F. A. S. and Brasil, F. C. (2015): Serological evidence of exposure to Anaplasma phagocytophilum in horses from the Rio de Janeiro state mounted police bred in the urban zone. Ciên. Anim. Bras. 16 ,377387.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rymaszewska, A. and Grenda, S. (2008): Bacteria of the genus Anaplasma – characteristics of Anaplasma and their vectors: a review. Vet. Med. 53 ,573584.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Salvagni, C. A., Dagnone, A. S., Gomes, T. S., Mota, J. S., Andrade, G. M., Baldani, C. D. and Machado, R. Z. (2010): Serologic evidence of equine granulocytic anaplasmosis in horses from central West Brazil. Rev. Bras. Parasitol. Vet. Jaboticabal 19 ,135140.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Schvartz, G., Epp, T., Burgess, H. J., Chilton, N. B., Pearl, D. L. and Lohmann, K. L. (2015): Seroprevalence of equine granulocytic anaplasmosis and Lyme borreliosis in Canada as determined by a point-of care enzyme-linked immunosorbent assay (ELISA). Can. Vet. J. 56 ,575580.

    • Search Google Scholar
    • Export Citation
  • Sellon, D. C. and Long, M. T. (2014): Anaplasma phagocytophilum infection. In: Sellon, D. C. and Long, M. T. (eds) Equine Infectious Diseases. 2nd edition. Saunders/Elsevier, St. Louis, Missouri. pp. 344347.

    • Search Google Scholar
    • Export Citation
  • Skarphédinsson, S., Jensen, P. M. and Kristiansen, K. (2005): Survey of tick-borne infections in Denmark. Emerg. Infect. Dis. 11 ,10551061.

  • Slivinska, K., Víchova, B., Werszko, J., Szewczyk, T., Wróblewski, Z., Peťko, B., Ragač, O., Demeshkant, V. and Karbowiak, G. (2016): Molecular surveillance of Theileria equi and Anaplasma phagocytophilum infections in horses from Ukraine, Poland and Slovakia. Vet. Parasitol. 215 ,3537.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Smetanová, K., Schwarzová, K. and Kocianová, E. (2006): Detection of Anaplasma phagocytophilum, Coxiella burnetti, Rickettsia spp., and Borrelia burgdorferi s. l. in ticks, and wild-living animals in Western and Middle Slovakia. Ann. N. Y. Acad. Sci. 1078 ,312315.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Svitálková, Z., Haruštiaková, D., Mahríková, L., Berthová, L., Slovák, M., Kocianová, E. and Kazimírová, M. (2015): Anaplasma phagocytophilum prevalence in ticks and rodents in an urban and natural habitat in South-Western Slovakia. Parasit. Vectors 8 ,276.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tate, C. M., Howerth, E. W., Mead, D. G., Dugan, V. G., Luttrell, P. M., Sahora, A. I., Munderloh, U. G., Davidson, W. R. and Yabsley, M. J. (2013): Anaplasma odocoilei sp. nov. (family Anaplasmataceae) from white-tailed deer (Odocoileus virginianus). Ticks Tick Borne Dis. 4 ,110119.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tomassone, L., Berriatua, E., De Sousa, R., Duscher, G. G., Mihalca, A. D., Silaghi, C., Sprong, H. and Zintl, A. (2018): Neglected vector-borne zoonoses in Europe: Into the wild. Vet. Parasitol. 251 ,1726.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tsachev, I., Baymakova, M. and Pantchev, N. (2019): Seroprevalence of Anaplasma phagocytophilum, Ehrlichia spp. and Borrelia burgdorferi infections in horses: first report from Northern Bulgaria – Short communication. Acta Vet. Hung. 67 ,197203.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Tsachev, I., Pantchev, N., Marutsov, P., Petrov, V., Gundasheva, D. and Baymakova, M. (2018): Serological evidence of Borrelia burgdorferi, Anaplasma phagocytophilum and Ehrlichia spp. infections in horses from Southeastern Bulgaria. Vector Borne Zoonotic Dis. 18 ,588594.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Van Andel, A. E., Maganrelli, L. A., Heimer, R. and Wilson, M. L. (1998): Development and duration of antibody response against Ehrlichia equi in horses. J. Am. Vet. Med. Assoc. 212 ,19101914.

    • Search Google Scholar
    • Export Citation
  • Vanstreels, R. E. T., Yabsley, M. J., Parsons, N. J., Swanepoel, L. and Pistorius, P. A. (2018): A novel candidate species of Anaplasma that infects avian erythrocytes. Parasit. Vectors 11 ,525.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Woldehiwet, Z. (2010): The natural history of Anaplasma phagocytophilum. Vet. Parasitol. 167 ,108122.

  • Yang, J., Han, R., Niu, Q., Liu, Z., Guan, G., Liu, G., Luo, J. and Yin, H. (2018): Occurrence of four Anaplasma species with veterinary and public health significance in sheep, northwestern China. Ticks Tick Borne Dis. 9 ,8285.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Yang, J., Li, Y., Liu, Z., Liu, J., Niu, Q., Ren, Q., Chen, Z., Guan, G., Luo, J. and Yin, H. (2015): Molecular detection and characterisation of Anaplasma spp. in sheep and cattle from Xinjiang, northwest China. Parasit. Vectors 8 ,108.

    • Crossref
    • Search Google Scholar
    • Export Citation

Author information is available in PDF.
Please, download the file from HERE.

The manuscript preparation instructions is available in PDF.
Please, download the file from HERE.

Senior editors

Editor-in-Chief: Mária BENKŐ

Managing Editor: András SZÉKELY

Editorial Board

  • Béla DÉNES (National Food Chain Safety Office, Budapest Hungary)
  • Edit ESZTERBAUER (Veterinary Medical Research Institute, Budapest, Hungary)
  • Hedvig FÉBEL (National Agricultural Innovation Centre, Herceghalom, Hungary)
  • László FODOR (University of Veterinary Medicine, Budapest, Hungary)
  • Balázs HARRACH (Veterinary Medical Research Institute, Budapest, Hungary)
  • Peter MASSÁNYI (Slovak University of Agriculture in Nitra, Nitra, Slovak Republic)
  • Béla NAGY (Veterinary Medical Research Institute, Budapest, Hungary)
  • Tibor NÉMETH (University of Veterinary Medicine, Budapest, Hungary)
  • Zsuzsanna NEOGRÁDY (University of Veterinary Medicine, Budapest, Hungary)
  • Alessandra PELAGALLI (University of Naples Federico II, Naples, Italy)
  • Kurt PFISTER (Ludwig-Maximilians-University of Munich, Munich, Germany)
  • László SOLTI (University of Veterinary Medicine, Budapest, Hungary)
  • József SZABÓ (University of Veterinary Medicine, Budapest, Hungary)
  • Péter VAJDOVICH (University of Veterinary Medicine, Budapest, Hungary)
  • János VARGA (University of Veterinary Medicine, Budapest, Hungary)
  • Štefan VILČEK (University of Veterinary Medicine in Kosice, Kosice, Slovak Republic)
  • Károly VÖRÖS (University of Veterinary Medicine, Budapest, Hungary)
  • Herbert WEISSENBÖCK (University of Veterinary Medicine, Vienna, Austria)
  • Attila ZSARNOVSZKY (Szent István University, Gödöllő, Hungary)

ACTA VETERINARIA HUNGARICA
Institute for Veterinary Medical Research
Centre for Agricultural Research
Hungarian Academy of Sciences
P.O. Box 18, H-1581 Budapest, Hungary
Phone: (36 1) 467 4081 (ed.-in-chief) or (36 1) 213 9793 (editor) Fax: (36 1) 467 4076 (ed.-in-chief) or (36 1) 213 9793

Indexing and Abstracting Services:

  • Biological Abstracts
  • BIOSIS Previews
  • CAB Abstracts
  • Chemical Abstracts
  • Current Contents: Agriculture, Biology and Environmental Sciences
  • Elsevier Science Navigator
  • Focus On: Veterinary Science and Medicine
  • Global Health
  • Index Medicus
  • Index Veterinarius
  • Medline
  • Science Citation Index
  • Science Citation Index Expanded (SciSearch)
  • SCOPUS
  • The ISI Alerting Services
  • Zoological Abstracts

 

2020  
Total Cites 987
WoS
Journal
Impact Factor
0,955
Rank by Veterinary Sciences 101/146 (Q3)
Impact Factor  
Impact Factor 0,920
without
Journal Self Cites
5 Year 1,164
Impact Factor
Journal  0,57
Citation Indicator  
Rank by Journal  Veterinary Sciences 93/166 (Q3)
Citation Indicator   
Citable 49
Items
Total 49
Articles
Total 0
Reviews
Scimago 33
H-index
Scimago 0,395
Journal Rank
Scimago Veterinary (miscellaneous) Q2
Quartile Score  
Scopus 355/217=1,6
Scite Score  
Scopus General Veterinary 73/183 (Q2)
Scite Score Rank  
Scopus 0,565
SNIP  
Days from  145
sumbission  
to acceptance  
Days from  150
acceptance  
to publication  
Acceptance 19%
Rate

 

2019  
Total Cites
WoS
798
Impact Factor 0,991
Impact Factor
without
Journal Self Cites
0,897
5 Year
Impact Factor
1,092
Immediacy
Index
0,119
Citable
Items
59
Total
Articles
59
Total
Reviews
0
Cited
Half-Life
9,1
Citing
Half-Life
9,2
Eigenfactor
Score
0,00080
Article Influence
Score
0,253
% Articles
in
Citable Items
100,00
Normalized
Eigenfactor
0,09791
Average
IF
Percentile
42,606
Scimago
H-index
32
Scimago
Journal Rank
0,372
Scopus
Scite Score
335/213=1,6
Scopus
Scite Score Rank
General Veterinary 62/178 (Q2)
Scopus
SNIP
0,634
Acceptance
Rate
18%

 

Acta Veterinaria Hungarica
Publication Model Hybrid
Submission Fee none
Article Processing Charge 1100 EUR/article
Printed Color Illustrations 40 EUR (or 10 000 HUF) + VAT / piece
Regional discounts on country of the funding agency World Bank Lower-middle-income economies: 50%
World Bank Low-income economies: 100%
Further Discounts Editorial Board / Advisory Board members: 50%
Corresponding authors, affiliated to an EISZ member institution subscribing to the journal package of Akadémiai Kiadó: 100%
Subscription fee 2021 Online subsscription: 696 EUR / 872 USD
Print + online subscription: 804 EUR / 1004 USD
Subscription fee 2022 Online subsscription: 710 EUR / 892 USD
Print + online subscription: 824 EUR / 1028 USD
Subscription Information Online subscribers are entitled access to all back issues published by Akadémiai Kiadó for each title for the duration of the subscription, as well as Online First content for the subscribed content.
Purchase per Title Individual articles are sold on the displayed price.

Acta Veterinaria Hungarica
Language English
Size A4
Year of
Foundation
1951
Publication
Programme
2020 Volume 68
Volumes
per Year
1
Issues
per Year
4
Founder Magyar Tudományos Akadémia
Founder's
Address
H-1051 Budapest, Hungary, Széchenyi István tér 9.
Publisher Akadémiai Kiadó
Publisher's
Address
H-1117 Budapest, Hungary 1516 Budapest, PO Box 245.
Responsible
Publisher
Chief Executive Officer, Akadémiai Kiadó
ISSN 0236-6290 (Print)
ISSN 1588-2705 (Online)

Monthly Content Usage

Abstract Views Full Text Views PDF Downloads
May 2021 0 0 0
Jun 2021 0 105 67
Jul 2021 0 87 46
Aug 2021 0 68 44
Sep 2021 0 43 37
Oct 2021 0 41 28
Nov 2021 0 0 0