Authors:
Dóra Török Department of Obstetrics and Food Animal Medicine Clinic, University of Veterinary Medicine, István u. 2, H-1078 Budapest, Hungary

Search for other papers by Dóra Török in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-5147-2513
,
Bence Somoskői Department of Obstetrics and Food Animal Medicine Clinic, University of Veterinary Medicine, István u. 2, H-1078 Budapest, Hungary

Search for other papers by Bence Somoskői in
Current site
Google Scholar
PubMed
Close
,
Lilla Bordás Department of Obstetrics and Food Animal Medicine Clinic, University of Veterinary Medicine, István u. 2, H-1078 Budapest, Hungary

Search for other papers by Lilla Bordás in
Current site
Google Scholar
PubMed
Close
,
Dóra Reglődi Department of Anatomy, MTA-PTE PACAP Research Group, Medical School, University of Pécs, Szigeti u. 12, H-7624 Pécs, Hungary

Search for other papers by Dóra Reglődi in
Current site
Google Scholar
PubMed
Close
, and
Sándor Cseh Department of Obstetrics and Food Animal Medicine Clinic, University of Veterinary Medicine, István u. 2, H-1078 Budapest, Hungary

Search for other papers by Sándor Cseh in
Current site
Google Scholar
PubMed
Close
Open access

Abstract

Pituitary adenylate cyclase-activating polypeptide (PACAP) is a neuropeptide with widespread occurrence and diverse functions. It occurs in high levels in the gonads suggesting a potential central role in reproduction. The aim of our study was to assess the effect of PACAP treatment during embryo vitrification on the developmental rate and the expression of the heparin-binding EGF-like growth factor gene (Hbegf). Mouse embryos, obtained from superovulated females were allocated into the four treatment groups. In EM1 and EM2, the embryos were prepared for vitrification in an Equilibration Solution that was supplemented with 1 or 2 μM PACAP1-38, respectively. The embyos in groups CM1 and CM2 were not treated prior to vitrification but were cultured in a medium supplemented with 1 or 2 μM PACAP1-38 after thawing. The Vitrified Control group consisted of embryos vitrified and thawed then cultured without PACAP1-38 treatment. A non-vitrified, non-treated Fresh Control group was also used. After 24 h of culture, the developmental rate of the embryos, as well as the relative expression level of the Hbegf gene, as determined by qPCR, were compared among groups. Higher developmental rate and Hbegf gene expression level were found in the embryos treated with a higher concentration of PACAP. These results indicate that PACAP treatment has a beneficial effect on the survival and development of vitrified/thawed mouse embryos.

Abstract

Pituitary adenylate cyclase-activating polypeptide (PACAP) is a neuropeptide with widespread occurrence and diverse functions. It occurs in high levels in the gonads suggesting a potential central role in reproduction. The aim of our study was to assess the effect of PACAP treatment during embryo vitrification on the developmental rate and the expression of the heparin-binding EGF-like growth factor gene (Hbegf). Mouse embryos, obtained from superovulated females were allocated into the four treatment groups. In EM1 and EM2, the embryos were prepared for vitrification in an Equilibration Solution that was supplemented with 1 or 2 μM PACAP1-38, respectively. The embyos in groups CM1 and CM2 were not treated prior to vitrification but were cultured in a medium supplemented with 1 or 2 μM PACAP1-38 after thawing. The Vitrified Control group consisted of embryos vitrified and thawed then cultured without PACAP1-38 treatment. A non-vitrified, non-treated Fresh Control group was also used. After 24 h of culture, the developmental rate of the embryos, as well as the relative expression level of the Hbegf gene, as determined by qPCR, were compared among groups. Higher developmental rate and Hbegf gene expression level were found in the embryos treated with a higher concentration of PACAP. These results indicate that PACAP treatment has a beneficial effect on the survival and development of vitrified/thawed mouse embryos.

Introduction

Pituitary adenylate cyclase-activating polypeptide (PACAP) is a neuropeptide belonging to the vasoactive intestinal peptide (VIP)/secretin/glucagon superfamily (Shioda and Nakamachi, 2015), of which it is a highly conserved member. The amino acid sequences of PACAP in all the different vertebrates share 84–100% identity, suggesting that PACAP is involved in important physiological processes (Isaac and Sherwood, 2008). The peptide plays roles in vasodilation, immunomodulation, cytoprotection and regulation of gastrointestinal, cardiovascular, respiratory and reproductive processes (Vaudry et al., 2009). The lack of PACAP in knockout animals leads to several biochemical and pathophysiological alterations, including increased cellular stress, early aging and pathological rhythmic functions (Reglodi et al., 2018a).

PACAP has several functions in the reproductive system. Among others, it plays a role in spermatogenesis (Reglodi et al., 2018b), in uterine innervation (Podlasz and Wasowicz, 2021) and acts as a hormonal regulator of the ovarian cycle (Winters and Moore, 2020). In the ovary, PACAP mRNA, protein and PAC1 receptors are found in the follicular and corpus luteum granulosa and theca cells (Isaac and Sherwood, 2008). In the regulation of oocyte maturation, PACAP might cooperate with other factors, including the epidermal growth factor (EGF)-like factors amphiregulin, epiregulin and beta-cellulin (Canipari et al., 2016). Watanabe et al. (2016) have found that PACAP promotes fertilization. Furthermore, in cumulus-oocyte complexes, pretreated with PACAP at different concentrations ranging from 10 nM to 1 μM, fertilization rates have increased in a dose-dependent manner (Tanii et al., 2011). In a study on PACAP and its role in embryo implantation in mice, it has been found that PACAP may have an important function at the beginning of gestation, specifically in implantation. PACAP null females, compared to wild-type female mice, have been found to have lower implantation rates, three times lower serum prolactin levels, lower serum progesterone levels and reduced live births (Isaac and Sherwood, 2008). In addition, PACAP may have a role in the secretion of placental hormones. In choriocarcinoma cells, PACAP has been found to cause a 12-fold increase in cAMP secretion. cAMP, in turn, stimulates the expression of the glycoprotein hormone alpha subunit in the placenta, which is a subunit present in the pituitary hormones LH, FSH and TSH, as well as human chorionic gonadotropin (Reglodi et al., 2012; Horvath et al., 2016).

In a recent study, we have shown positive effects of PACAP on mouse preimplantation embryo development (Török et al., 2018). Our results have revealed a connection between endometrial PACAP levels and embryo development. Furthermore, our group has found positive correlation between the mRNA levels of Adcyap1 (the gene coding for PACAP) and Hbegf (the gene coding for the heparin binding EGF-like factor) (Somoskői et al., 2020). Since Hbegf reaches its expression peak 5–8 days after the ovulation in uterus epithelial cells, and it is also expressed by the embryonic trophoblast before the implantation (Hamatani et al., 2004), these results suggest that PACAP, together with HB-EGF, plays an important role in implantation (Somoskői et al., 2020). Previously, it has been shown that, the supplementation of the cryopreservation solution with PACAP in case of small-bowel autotransplantation led to amelioration of the small intestinal oxidative stress and structural lesions during the cold preservation/reperfusion injury (Ferencz et al., 2009). These results raise the possibility that PACAP might be protective in embryo vitrification. The aim of our present study was to assess the effect of PACAP treatment, applied prior to vitrification or after thawing, on mouse embryo developmental and implantation potential, estimated by measuring the relative expression level of the Hbegf gene.

Materials and methods

Animal housing, mating and embryo collection

Procedures with animals were performed following good veterinary practice established for animal welfare according to Hungarian national laws in force. The protocol of the animal experiment was approved by the Food Chain Safety and Animal Health Directorate of Pest County's Government Office (PE/EA/1062-6/2021). Eight-week-old BDF1 (National Institute of Oncology, Budapest, Hungary) mice were kept under a 12 h light/12 h dark schedule at a temperature of 21 °C with 30% relative humidity in the air. Feed and drinking water were available ad libitum. Female mice were superovulated by i.p. injection of 7.5 IU equine serum gonadotropin (Folligon, Intervet, Germany) followed by 7.5 IU human chorionic gonadotropin i.p. (Veterin corion, Alvetra und Werfft, Austria) after 48 h. Then the females were placed together with mature males overnight.

Embryos were collected on Day 1 (E1.0) from the ampulla and washed in PBS + 20% FBS (Fetal bovine serum, Sigma-Aldrich, Canada), then they were cultured in vitro in G-1™ PLUS medium (Vitrolife, Sweden) for 72 h (37.5 °C, 6.5% CO2, maximum humidity).

We obtained embryos from 23 females, of which a total of 347 embryos were vitrified after 72 h of in vitro culture. RNA extraction was performed on 204 embryos (30 per group) included Fresh Control group. Embryos were randomly allocated into the groups.

Treatment groups

Six groups were established. In the Fresh Control group, the embryos were cultured without any treatment and after Day 3 of culture they were placed in culture medium (CM) G-2™ PLUS (Vitrolife, Sweden) for 24 h. The Vitrified Control group contained embryos that were vitrified on Day 3 of culture using the vitrification protocol detailed below. The embryos were then thawed and cultured in vitro in CM without any treatment for 24 h. There were four PACAP-treated groups. In two of these (EM 1 and EM 2), the treatment was carried out during the preparation for vitrification, when the Equilibration Medium was supplemented with 1 or 2 µM PACAP1-38. The full-length 38-amino acid peptide (PACAP-38) was synthesized at the Department of Medical Chemistry of the University of Szeged (Hungary) as described previously (Figueiredo et al., 2022). After thawing, the embryos were cultured for 24 h in CM without any supplementation. The embryos in the other two groups were treated only after thawing by supplementing the CM with 1 or 2 µM PACAP1-38 (groups CM 1 and CM 2, respectively). The treatment groups are summarized in Table 1.

Table 1.

Summary of treatments in the experimental groups

Group nameVitrificationPACAP1-38 in EMPACAP1-38 in CM
Fresh Control
Vitrified Control
EM 11 µM
EM 22 µM
CM 11 µM
CM 22 µM

EM: equilibration medium; CM: culture medium

Vitrification

After 72 h of in vitro culture, the developmental stage and quality of embryos were examined under stereomicroscope and evaluated based on their morphology characteristics. Only grade 1 blastocysts were vitrified. First, the embryos were washed in Holding Medium i.e. HEPES-modified Medium 199 (Thermo Fisher Scientific, Waltham, MA, USA) + 20% foetal bovine serum (FBS), then incubated in EM (Equilibration Medium: Holding Medium + 7.5% ethylene glycol (EG) + 7.5% dimethyl sulfoxide (DMSO) (both Sigma-Aldrich, Canada) at room temperature for 3 min. Then, embryos were transferred into VM (Vitrification Medium: HEPES-modified Medium 199 + 1M sucrose + 20% FBS + 16.5% EG + 16.5% DMSO) for 20 s, collected into an open pulled straw and plunged into liquid nitrogen. Vitrified samples were stored for one week in liquid nitrogen.

Thawing and in vitro culture

According to the thawing protocol, embryos were washed in Holding Medium + 50% sucrose medium (SM) (HEPES-modified Medium 199 + 1M sucrose + 20% FBS) for 5 min, then the amount of SM was gradually reduced (Holding Medium + 25% SM) during further washes for another 5 min. Finally, the embryos were collected in Holding Medium. After the thawing, we cultured the embryos in CM for 24 h. After 24 h in culture, we recorded the developmental rate (number of re-expanded and further developed embryos divided by the total number of vitrified embryos expressed as a percentage) and determined the Hbegf gene expression by qPCR in each of the embryos, individually.

RNA extraction

The total RNA from the embryos was extracted using the column-based Direct-zol RNA MiniPrep kit (Zymo Research, Irvine, CA, USA) according to the manufacturer's instructions. In-column DNase treatment was applied to remove the residual DNA.

cDNA preparation and quantitative PCR

Reverse transcription of the RNA samples was carried out with oligoDT using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA) using the manufacturer's instructions and primers. The PCR analysis was performed with FastStart Essential DNA Green Master (Roche Diagnostics, Basel, Switzerland). The mRNA expression levels of Hbegf were normalized to that of a house-keeping enzyme, namely the glyceraldehyde 3-phosphate dehydrogenase (Gapdh). Table 2 shows the nucleotide sequences of forward and reverse primers for both genes (Gapdh and Hbegf). The Gapdh primers have been published previously, whereas the primers for the Hbegf gene were designed using the SnapGene software (GSL Biotech LLC). The qPCR was carried out in a Roche LightCycler Nano real-time PCR system (Roche Diagnostics, Basel, Switzerland). The cycling conditions consisted of an initial denaturation and enzyme activation step at 95 °C for 2 min, followed by 45 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s and extension steps at 72 °C for 30 s. To evaluate the results, we normalized the obtained Threshold Cycle (Ct) values. For this, we used the following formula: 2ΔCt, where ΔCt = Ct housekeeping gene - Ct tested gene. Thus, the expression level of the Hbegf gene was determined relative to that of the Gapdh gene.

Table 2.

Sequences of the PCR primers used for the detection of the genes of the enzyme glyceraldehyde 3-phosphate dehydrogenase (Gapdh) and the heparin-binding EGF-like growth factor (Hbegf)

GeneForwardReverseReference
Mouse GapdhGCTACACTGAGGACCAGGTTGTCTCCTGTTATTATGGGGGTCTGXu et al. (2016)
HbegfCTGAAGGTTCCTATAGCTCAGGTCCTGAGAGACCCATGCCTCAGGAAATACDesigned in house

Statistical analysis

The data were analyzed with R v3.0.0 software (R Development Core Team). Difference of developmental rate in controls and treated groups were analyzed with Chi-squared test. Effect of PACAP on Hbegf expression levels was analyzed with Kruskal-Wallis rank sum test, with post hoc pairwise comparison using Wilcoxon rank sum test (p-adjustment method by Benjamini and Hochberg, 1995). Differences at a probability value of P < 0.05 were considered significant.

Results

Effect of PACAP treatment on developmental rate of mouse embryos

As shown in Fig. 1, the developmental rate in group EM 2, was 90.9% (50/55), significantly higher compared to Vitrified Control group (68.8%, 44/64, P = 0.0031). It was also significantly higher than that in groups EM 1 (69.6%, 39/56, P < 0.0001), CM 1 (54.9%, 56/102, P < 0.0001) and CM 2 (68.6%, 48/70, P = 0.0026). No significant difference was found between the groups treated with PACAP after vitrification (CM 1 and CM 2).

Fig. 1.
Fig. 1.

Developmental rate of mouse embryos in the different treatment groups after vitrification and 24-h post-thaw in vitro culture. *Statistically significant difference (P = 0.0031)

Citation: Acta Veterinaria Hungarica 71, 2; 10.1556/004.2023.00903

Effect of PACAP treatment on the relative expression level of Hbegf gene

In the amount of specific mRNA levels, there was no significant difference between the Fresh and the Vitrified Control groups. No significant difference was seen in the EM 1 group either. We observed significantly higher relative Hbegf expression levels in embryos treated with higher dose (2 µM) of PACAP during the preparation for vitrification (EM 2) compared to the embryos in the Fresh Control group (P = 0.01265). The relative expression level of Hbegf was significantly lower in embryos treated with PACAP during the in vitro culture after the vitrification (CM 1, CM 2) compared to the other groups, but there was no difference between the two PACAP doses (Fig. 2).

Fig. 2.
Fig. 2.

Means (±SE) of the relative expression levels of Hbegf gene of embryos in each treatment group as compared to that of the gene of house-keeping enzyme glyceraldehyde 3-phosphate dehydrogenase. *, #, $ mark significant differences (P < 0.05) compared to Fresh Control, Vitrified Control and during vitrification PACAP-treated groups, respectively

Citation: Acta Veterinaria Hungarica 71, 2; 10.1556/004.2023.00903

Discussion

Our results revealed a higher rate of development in the group of mouse embryos treated with a higher dose of PACAP during vitrification. Cryopreservation induces oxidative stress in cells due to the harmful effect of the cryoprotective agents (CPAs). Ahn et al. (2002) have observed physical and chemical changes in frozen-thawed, two-cell mouse embryos, such as the destruction of the cell membrane integrity, redistribution of actin fibers, mitochondrial depolarizations and increased production of reactive oxygen species (ROS), which may trigger the apoptotic cascade leading to a decrease in the survival rate and in the developmental rate of the embryos. Several other studies have revealed that oxidative stress is associated with early developmental impairment and embryo fragmentation and induces apoptosis in oocytes and early embryos (Takahashi et al., 2000; Dennery, 2007; Takahashi, 2012). Dhali et al. (2007) have found lower blastocyst ratios in vitrified, as well as in non-vitrified but cryoprotectant-treated embryos compared to the control group. This suggests that the toxicity of CPAs and/or the dehydration and osmotic events significantly damage the embryos.

We found a significantly higher rate of post-thaw development in embryos vitrified using EM containing 2 μM of PACAP compared to the Vitrified Control group. However, if PACAP was used after thawing during the in vitro culturing (CM 1, CM 2), no significant difference was found in the developmental rate compared to the Vitrified Control embryos. It can be assumed that the presence of PACAP during the 3-min incubation in EM primed the embryos to better withstand the damaging effects of cryopreservation and even brought about protective effects during the subsequent 24-h post-thaw in vitro culture. In contrast, the presence of PACAP in the CM resulted in no advantage. Our observation suggests that PACAP treatment has a beneficial effect on mouse embryo survival as it can reduce the harmful effects of the cryopreservation/vitrification process. This hypothesis is supported by several studies indicating that PACAP has a significant antiapoptotic effect as well as providing protection against oxidative stress and toxins (Lee et al., 1999; Morelli et al., 2008).

Vitrification can alter or modify gene expression and transcriptional activities. It has been observed that vitrification increases the expression levels of apoptotic genes. Majidi Gharenaz et al. (2016) has found a significantly higher Bax pro-apoptotic and significantly lower Bcl-2 anti-apoptotic gene expression in re-vitrified embryos compared to fresh embryos. However, no significant difference has been observed between re-vitrified and vitrified groups. These results can be related to the experiences of the previously mentioned study, in which a strong relationship has been found between the compromised developmental competence and altered transcriptional activities of Bax and Bcl-2 genes in the vitrified embryos (Dhali et al., 2007). Furthermore, Majidi Gharenaz et al. (2016) have observed a significantly lower level of ErbB4 gene expression in re-vitrified embryos compared to fresh embryos, and similar levels have been found in vitrified embryos as in re-vitrified embryos. Interaction between ErbB4 and HB-EGF mediates the attachment of blastocyst to the endometrium (Paria et al., 1993; Lim et al., 2006; Davidson and Coward, 2016). Signalling by HB-EGF back to the embryo, in turn, activates the program of trophoblast differentiation required for adhesive functions during subsequent attachment and invasion (Lim et al., 2006; Davidson and Coward, 2016). Connected with the expression of Hbegf in embryos treated with high dose of PACAP during vitrification, Majidi Gharenaz et al. (2016) have found opposite result, since unlike us, they have observed low expression levels. Gazor et al. (2018) have found a negative effect of cryopreservation on epidermal growth factor receptor (EGFR) gene expression. This has been confirmed also by Riesco and Robles (2013). These data suggest that gene expression might change during the vitrification and thawing procedure. Their explanation is that cryopreservation affects the stability of mRNA and therefore some of them are susceptible to degradation. The regulation of some mRNAs involve translation inhibition. Reduction and even elimination of some transcripts as a result of cryopreservation, have also been observed as reported by García-Herrero et al. (2011). In the view of the fact that we found higher level of Hbegf expression in embryos treated with 2 μM PACAP during vitrification compared to the Fresh Control group suggests that exogenous PACAP might protect the embryo from the previously mentioned damaging effect of cryopreservation. Shaw et al. (2012) have studied gene expression in fresh and frozen-thawed human preimplantation embryos. They have found significantly lower gene expression levels after thawing. Similarly, we also experienced significantly lower Hbegf expression levels in the groups of CM 1 and CM 2. Our data indicate that if the PACAP supplementation in the CM is used after freezing-thawing, PACAP is no longer able to exert the protective effect after the vitrification. Further studies are needed to find the explanation to this phenomenon.

It has been reported, that Hbegf, expressed by the implantation-competent blastocyst induces Hbegf expression in the uterine endometrium in a paracrine manner (Hamatani et al., 2004). The synthesized HB-EGF improves development of the embryo to the hatching blastocyst stage, promotes trophoblast outgrowth and regulates trophoblast activity during implantation (Lim et al., 2006). Furthermore, HB-EGF induces the uterine expression of Ptgs2, the gene of the prostaglandin-endoperoxide synthase. Lim et al. (1997) have found defective implantation and decidualization in Ptgs2 KO mice. This suggests that the chance of implantation can be predicted from the expression level of this gene. Higher HB-EGF levels have been associated with higher implantation rates (Lim et al., 2006). Based on our research, higher expression levels were found in PACAP-treated embryos compared to fresh embryos, indicating that PACAP treatment prior to and during vitrification has a beneficial effect on Hbegf gene expression, thus on the probability of implantation in a dose-dependent manner.

Acknowledgements

The project was supported by the Hungarian Research Fund (OTKA 115874); NKFIHK135457; TKP2020-IKA-08, MTA-TKI-14016. Project no. TKP2020-NKA-01 has been implemented with the support provided from the National Research, Development and Innovation Fund of Hungary, financed under the Tématerületi Kiválósági Program 2020 (2020-4.1.1-TKP2020) funding scheme. Project no. 134887 has been implemented with the support provided by the Ministry of Innovation and Technology of Hungary from the National Research, Development and Innovation Fund, financed under the FK_20 funding scheme. Thematic Excellence Program 2021 Health Sub-programme of the Ministry for Innovation and Technology in Hungary, within the framework of the EGA-16 project of the University Pécs.

References

  • Ahn, H. J., Sohn, I. P., Kwon, H. C., Jo, D. H., Park, Y. D. and Min, C. K. (2002): Characteristics of the cell membrane fluidity, actin fibers, and mitochondrial dysfunctions of frozen-thawed two-cell mouse embryos. Mol. Reprod. Dev. 61, 466476. https://doi.org/10.1002/mrd.10040.

    • Search Google Scholar
    • Export Citation
  • Benjamini Y, and Hochberg Y. (1995): Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. Statist. Soc. B. 57, 289300. https://doi.org/10.1111/j.2517-6161.1995.tb02031.x.

    • Search Google Scholar
    • Export Citation
  • Canipari, R., Di Paolo, V., Barberi, M. and Cecconi, S. (2016): PACAP in the reproductive system. In D. Reglodi and A. Tamas (Eds.), Pituitary Adenylate Cyclase Activating Polypeptide-PACAP (pp. 405420). Springer International Publishing. https://doi.org/10.1007/978-3-319-35135-3_24.

    • Search Google Scholar
    • Export Citation
  • Davidson, L. M., and Coward, K. (2016): Molecular mechanisms of membrane interaction at implantation. Birth Defects Res. C Embryo Today 108, 1932. https://doi.org/10.1002/bdrc.21122.

    • Search Google Scholar
    • Export Citation
  • Dennery, P. A. (2007): Effects of oxidative stress on embryonic development. Birth Defects Res. C Embryo Today 81, 155162. https://doi.org/10.1002/bdrc.20098.

    • Search Google Scholar
    • Export Citation
  • Dhali, A., Anchamparuthy, V. M., Butler, S. P., Pearson, R. E., Mullarky, I. K. and Gwazdauskas, F. C. (2007): Gene expression and development of mouse zygotes following droplet vitrification. Theriogenology 68, 12921298. https://doi.org/10.1016/j.theriogenology.2007.08.030.

    • Search Google Scholar
    • Export Citation
  • Ferencz, A., Racz, B., Tamas, A., Reglodi, D., Lubics, A., Nemeth, J., Nedvig, K., Kalmar-Nagy, K., Horvath, O. P., Weber, G. and Roth, E. (2009): Influence of PACAP on oxidative stress and tissue injury following small-bowel autotransplantation. J. Mol. Neurosci. 37, 168176. https://doi.org/10.1007/s12031-008-9132-0.

    • Search Google Scholar
    • Export Citation
  • Figueiredo, C. A., Düsedau, H. P., Steffen, J., Ehrentraut, S., Dunay, M. P., Toth, G., Reglödi, D., Heimesaat, M. M. and Dunay, I. R. (2022): The neuropeptide PACAP alleviates T. gondii infection-induced neuroinflammation and neuronal impairment. J. Neuroinflammation 19, 274. https://doi.org/10.1186/s12974-022-02639-z.

    • Search Google Scholar
    • Export Citation
  • García-Herrero, S., Garrido, N., Martínez-Conejero, J. A., Remohí, J., Pellicer, A. and Meseguer, M. (2011): Differential transcriptomic profile in spermatozoa achieving pregnancy or not via ICSI. Reprod. Biomed. Online 22, 2536. https://doi.org/10.1016/j.rbmo.2010.09.013.

    • Search Google Scholar
    • Export Citation
  • Gazor, R., Eskandari, M., Sharafshah, A., Bahadori, M. H., Golmohammadi, M. G. and Keshavarz, P. (2018): Assessment of EGFR gene expression following vitrification of 2-cell and blastocyst mouse embryos. Avicenna J. Med. Biotechnol. 10, 120122.

    • Search Google Scholar
    • Export Citation
  • Hamatani, T., Daikoku, T., Wang, H., Matsumoto, H., Carter, M. G., Ko, M. S. H. and Dey, S. K. (2004): Global gene expression analysis identifies molecular pathways distinguishing blastocyst dormancy and activation. Proc. Natl. Acad. Sci. U.S.A. 101, 1032610331. https://doi.org/10.1073/pnas.0402597101.

    • Search Google Scholar
    • Export Citation
  • Horvath, G., Nemeth, J., Brubel, R., Opper, B., Koppan, M., Tamas, A., Szereday, L. and Reglodi, D. (2016): Occurrence and functions of PACAP in the placenta. In D. Reglodi and A. Tamas (Eds.), Pituitary Adenylate Cyclase Activating Polypeptide—PACAP (Vol. 11, pp. 389403). Springer International Publishing. https://doi.org/10.1007/978-3-319-35135-3_23.

    • Search Google Scholar
    • Export Citation
  • Isaac, E. R. and Sherwood, N. M. (2008): Pituitary adenylate cyclase-activating polypeptide (PACAP) is important for embryo implantation in mice. Mol. Cell. Endocrinol. 280, 1319. https://doi.org/10.1016/j.mce.2007.09.003.

    • Search Google Scholar
    • Export Citation
  • Lee, J., Park, H. J., Choi, H. S., Kwon, H. B., Arimura, A., Lee, B. J., Choi, W. S. and Chun, S. Y. (1999): Gonadotropin stimulation of pituitary adenylate cyclase-activating polypeptide (PACAP) messenger ribonucleic acid in the rat ovary and the role of PACAP as a follicle survival factor. Endocrinology 140, 818826. https://doi.org/10.1210/endo.140.2.6485.

    • Search Google Scholar
    • Export Citation
  • Lim, H., Paria, B. C., Das, S. K., Dinchuk, J. E., Langenbach, R., Trzaskos, J. M. and Dey, S. K. (1997): Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91, 197208. https://doi.org/10.1016/s0092-8674(00)80402-x.

    • Search Google Scholar
    • Export Citation
  • Lim, J. J., Lee, D. R., Song, H.-S., Kim, K.-S., Yoon, T. K., Gye, M. C. and Kim, M. K. (2006): Heparin-binding epidermal growth factor (HB-EGF) may improve embryonic development and implantation by increasing vitronectin receptor (integrin ανβ3) expression in peri-implantation mouse embryos. J. Assist. Reprod. Genet. 23, 111119. https://doi.org/10.1007/s10815-006-9021-9.

    • Search Google Scholar
    • Export Citation
  • Majidi Gharenaz, N., Movahedin, M., Mazaheri, Z. and Pour beiranvand, S. (2016): Alternation of apoptotic and implanting genes expression of mouse embryos after re-vitrification. Int. J. Reprod. BioMed. 14, 511518.

    • Search Google Scholar
    • Export Citation
  • Morelli, M. B., Barberi, M., Gambardella, A., Borini, A., Cecconi, S., Coticchio, G. and Canipari, R. (2008): Characterization, expression, and functional activity of pituitary adenylate cyclase-activating polypeptide and its receptors in human granulosa-luteal cells. J. Clin. Endocrinol. Metab. 93, 49244932. https://doi.org/10.1210/jc.2007-2621.

    • Search Google Scholar
    • Export Citation
  • Paria, B. C., Das, S. K., Andrews, G. K. and Dey, S. K. (1993): Expression of the epidermal growth factor receptor gene is regulated in mouse blastocysts during delayed implantation. Proc. Natl. Acad. Sci. U.S.A. 90, 5559. https://doi.org/10.1073/pnas.90.1.55.

    • Search Google Scholar
    • Export Citation
  • Podlasz, P. and Wasowicz, K. (2021): Effect of partial hysterectomy on the neurons of the paracervical ganglion (PCG) of the pig. PLoS One 16, e0245974. https://doi.org/10.1371/journal.pone.0245974.

    • Search Google Scholar
    • Export Citation
  • Reglodi, D., Atlasz, T., Szabo, E., Jungling, A., Tamas, A., Juhasz, T., Fulop, B. D. and Bardosi, A. (2018a): PACAP deficiency as a model of aging. GeroScience 40, 437452. https://doi.org/10.1007/s11357-018-0045-8.

    • Search Google Scholar
    • Export Citation
  • Reglodi, D., Cseh, S., Somoskoi, B., Fulop, B. D., Szentleleky, E., Szegeczki, V., Kovacs, A., Varga, A., Kiss, P., Hashimoto, H., Tamas, A., Bardosi, A., Manavalan, S., Bako, E., Zakany, R. and Juhasz, T. (2018b): Disturbed spermatogenic signaling in pituitary adenylate cyclase activating polypeptide-deficient mice. Reproduction 155, 127137. https://doi.org/10.1530/REP-17-0470.

    • Search Google Scholar
    • Export Citation
  • Reglodi, D., Tamas, A., Koppan, M., Szogyi, D. and Welke, L. (2012): Role of PACAP in female fertility and reproduction at gonadal level – recent advances. Front. Endocrinol. 3, 155. https://doi.org/10.3389/fendo.2012.00155.

    • Search Google Scholar
    • Export Citation
  • Riesco, M. F. and Robles, V. (2013): Cryopreservation causes genetic and epigenetic changes in zebrafish genital ridges. PLoS One 8, e67614. https://doi.org/10.1371/journal.pone.0067614.

    • Search Google Scholar
    • Export Citation
  • Shaw, L., Sneddon, S. F., Brison, D. R. and Kimber, S. J. (2012): Comparison of gene expression in fresh and frozen–thawed human preimplantation embryos. Reproduction 144, 569582. https://doi.org/10.1530/REP-12-0047.

    • Search Google Scholar
    • Export Citation
  • Shioda, S. and Nakamachi, T. (2015): PACAP as a neuroprotective factor in ischemic neuronal injuries. Peptides 72, 202207. https://doi.org/10.1016/j.peptides.2015.08.006.

    • Search Google Scholar
    • Export Citation
  • Somoskői, B., Török, D., Reglodi, D., Tamas, A., Fülöp, B. and Cseh, S. (2020): Possible effects of pituitary adenylate cyclase activating polypeptide (PACAP) on early embryo implantation marker HB-EGF in mouse. Reprod. Biol. 20. https://doi.org/10.1016/j.repbio.2020.01.005.

    • Search Google Scholar
    • Export Citation
  • Takahashi, M. (2012): Oxidative stress and redox regulation on in vitro development of mammalian embryos. J. Reprod. Dev. 58, 19. https://doi.org/10.1262/jrd.11-138n.

    • Search Google Scholar
    • Export Citation
  • Takahashi, M., Keicho, K., Takahashi, H., Ogawa, H., Schultz, R. M. and Okano, A. (2000): Effect of oxidative stress on development and DNA damage in in-vitro cultured bovine embryos by comet assay. Theriogenology 54, 137145. https://doi.org/10.1016/s0093-691x(00)00332-0.

    • Search Google Scholar
    • Export Citation
  • Tanii, I., Aradate, T., Matsuda, K., Komiya, A. and Fuse, H. (2011): PACAP-mediated sperm-cumulus cell interaction promotes fertilization. Reproduction 141, 163171. https://doi.org/10.1530/REP-10-0201.

    • Search Google Scholar
    • Export Citation
  • Török, D., Somoskői, B., Reglődi, D., Tamás, A., Fülöp, B. and Cseh, S. (2018): Effects of hypophysis adenylate cyclase activating polypeptide on female cycle and embryo development in mice-Preliminary results. [In Hungarian], Magy. Allatorvosok 140, 181187.

    • Search Google Scholar
    • Export Citation
  • Vaudry, D., Falluel-Morel, A., Bourgault, S., Basille, M., Burel, D., Wurtz, O., Fournier, A., Chow, B. K. C., Hashimoto, H., Galas, L. and Vaudry, H. (2009): Pituitary adenylate cyclase-activating polypeptide and its receptors: 20 years after the discovery. Pharmacol. Rev. 61, 283357. https://doi.org/10.1124/pr.109.001370.

    • Search Google Scholar
    • Export Citation
  • Watanabe, J., Seki, T. and Shioda, S. (2016): PACAP and neural development. In D. Reglodi and A. Tamas (Eds.), Pituitary Adenylate Cyclase Activating Polypeptide—PACAP (pp. 6582). Springer International Publishing. https://doi.org/10.1007/978-3-319-35135-3_6.

    • Search Google Scholar
    • Export Citation
  • Winters, S. J. and Moore, J. P. (2020): PACAP: a regulator of mammalian reproductive function. Mol. Cell. Endocrinol. 518, 110912. https://doi.org/10.1016/j.mce.2020.110912.

    • Search Google Scholar
    • Export Citation
  • Xu, Z., Ohtaki, H., Watanabe, J., Miyamoto, K., Murai, N., Sasaki, S., Matsumoto, M., Hashimoto, H., Hiraizumi, Y., Numazawa, S. and Shioda, S. (2016): Pituitary adenylate cyclase-activating polypeptide (PACAP) contributes to the proliferation of hematopoietic progenitor cells in murine bone marrow via PACAP-specific receptor. Sci. Rep. 6, 22373. https://doi.org/10.1038/srep22373.

    • Search Google Scholar
    • Export Citation
  • Ahn, H. J., Sohn, I. P., Kwon, H. C., Jo, D. H., Park, Y. D. and Min, C. K. (2002): Characteristics of the cell membrane fluidity, actin fibers, and mitochondrial dysfunctions of frozen-thawed two-cell mouse embryos. Mol. Reprod. Dev. 61, 466476. https://doi.org/10.1002/mrd.10040.

    • Search Google Scholar
    • Export Citation
  • Benjamini Y, and Hochberg Y. (1995): Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. Statist. Soc. B. 57, 289300. https://doi.org/10.1111/j.2517-6161.1995.tb02031.x.

    • Search Google Scholar
    • Export Citation
  • Canipari, R., Di Paolo, V., Barberi, M. and Cecconi, S. (2016): PACAP in the reproductive system. In D. Reglodi and A. Tamas (Eds.), Pituitary Adenylate Cyclase Activating Polypeptide-PACAP (pp. 405420). Springer International Publishing. https://doi.org/10.1007/978-3-319-35135-3_24.

    • Search Google Scholar
    • Export Citation
  • Davidson, L. M., and Coward, K. (2016): Molecular mechanisms of membrane interaction at implantation. Birth Defects Res. C Embryo Today 108, 1932. https://doi.org/10.1002/bdrc.21122.

    • Search Google Scholar
    • Export Citation
  • Dennery, P. A. (2007): Effects of oxidative stress on embryonic development. Birth Defects Res. C Embryo Today 81, 155162. https://doi.org/10.1002/bdrc.20098.

    • Search Google Scholar
    • Export Citation
  • Dhali, A., Anchamparuthy, V. M., Butler, S. P., Pearson, R. E., Mullarky, I. K. and Gwazdauskas, F. C. (2007): Gene expression and development of mouse zygotes following droplet vitrification. Theriogenology 68, 12921298. https://doi.org/10.1016/j.theriogenology.2007.08.030.

    • Search Google Scholar
    • Export Citation
  • Ferencz, A., Racz, B., Tamas, A., Reglodi, D., Lubics, A., Nemeth, J., Nedvig, K., Kalmar-Nagy, K., Horvath, O. P., Weber, G. and Roth, E. (2009): Influence of PACAP on oxidative stress and tissue injury following small-bowel autotransplantation. J. Mol. Neurosci. 37, 168176. https://doi.org/10.1007/s12031-008-9132-0.

    • Search Google Scholar
    • Export Citation
  • Figueiredo, C. A., Düsedau, H. P., Steffen, J., Ehrentraut, S., Dunay, M. P., Toth, G., Reglödi, D., Heimesaat, M. M. and Dunay, I. R. (2022): The neuropeptide PACAP alleviates T. gondii infection-induced neuroinflammation and neuronal impairment. J. Neuroinflammation 19, 274. https://doi.org/10.1186/s12974-022-02639-z.

    • Search Google Scholar
    • Export Citation
  • García-Herrero, S., Garrido, N., Martínez-Conejero, J. A., Remohí, J., Pellicer, A. and Meseguer, M. (2011): Differential transcriptomic profile in spermatozoa achieving pregnancy or not via ICSI. Reprod. Biomed. Online 22, 2536. https://doi.org/10.1016/j.rbmo.2010.09.013.

    • Search Google Scholar
    • Export Citation
  • Gazor, R., Eskandari, M., Sharafshah, A., Bahadori, M. H., Golmohammadi, M. G. and Keshavarz, P. (2018): Assessment of EGFR gene expression following vitrification of 2-cell and blastocyst mouse embryos. Avicenna J. Med. Biotechnol. 10, 120122.

    • Search Google Scholar
    • Export Citation
  • Hamatani, T., Daikoku, T., Wang, H., Matsumoto, H., Carter, M. G., Ko, M. S. H. and Dey, S. K. (2004): Global gene expression analysis identifies molecular pathways distinguishing blastocyst dormancy and activation. Proc. Natl. Acad. Sci. U.S.A. 101, 1032610331. https://doi.org/10.1073/pnas.0402597101.

    • Search Google Scholar
    • Export Citation
  • Horvath, G., Nemeth, J., Brubel, R., Opper, B., Koppan, M., Tamas, A., Szereday, L. and Reglodi, D. (2016): Occurrence and functions of PACAP in the placenta. In D. Reglodi and A. Tamas (Eds.), Pituitary Adenylate Cyclase Activating Polypeptide—PACAP (Vol. 11, pp. 389403). Springer International Publishing. https://doi.org/10.1007/978-3-319-35135-3_23.

    • Search Google Scholar
    • Export Citation
  • Isaac, E. R. and Sherwood, N. M. (2008): Pituitary adenylate cyclase-activating polypeptide (PACAP) is important for embryo implantation in mice. Mol. Cell. Endocrinol. 280, 1319. https://doi.org/10.1016/j.mce.2007.09.003.

    • Search Google Scholar
    • Export Citation
  • Lee, J., Park, H. J., Choi, H. S., Kwon, H. B., Arimura, A., Lee, B. J., Choi, W. S. and Chun, S. Y. (1999): Gonadotropin stimulation of pituitary adenylate cyclase-activating polypeptide (PACAP) messenger ribonucleic acid in the rat ovary and the role of PACAP as a follicle survival factor. Endocrinology 140, 818826. https://doi.org/10.1210/endo.140.2.6485.

    • Search Google Scholar
    • Export Citation
  • Lim, H., Paria, B. C., Das, S. K., Dinchuk, J. E., Langenbach, R., Trzaskos, J. M. and Dey, S. K. (1997): Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91, 197208. https://doi.org/10.1016/s0092-8674(00)80402-x.

    • Search Google Scholar
    • Export Citation
  • Lim, J. J., Lee, D. R., Song, H.-S., Kim, K.-S., Yoon, T. K., Gye, M. C. and Kim, M. K. (2006): Heparin-binding epidermal growth factor (HB-EGF) may improve embryonic development and implantation by increasing vitronectin receptor (integrin ανβ3) expression in peri-implantation mouse embryos. J. Assist. Reprod. Genet. 23, 111119. https://doi.org/10.1007/s10815-006-9021-9.

    • Search Google Scholar
    • Export Citation
  • Majidi Gharenaz, N., Movahedin, M., Mazaheri, Z. and Pour beiranvand, S. (2016): Alternation of apoptotic and implanting genes expression of mouse embryos after re-vitrification. Int. J. Reprod. BioMed. 14, 511518.

    • Search Google Scholar
    • Export Citation
  • Morelli, M. B., Barberi, M., Gambardella, A., Borini, A., Cecconi, S., Coticchio, G. and Canipari, R. (2008): Characterization, expression, and functional activity of pituitary adenylate cyclase-activating polypeptide and its receptors in human granulosa-luteal cells. J. Clin. Endocrinol. Metab. 93, 49244932. https://doi.org/10.1210/jc.2007-2621.

    • Search Google Scholar
    • Export Citation
  • Paria, B. C., Das, S. K., Andrews, G. K. and Dey, S. K. (1993): Expression of the epidermal growth factor receptor gene is regulated in mouse blastocysts during delayed implantation. Proc. Natl. Acad. Sci. U.S.A. 90, 5559. https://doi.org/10.1073/pnas.90.1.55.

    • Search Google Scholar
    • Export Citation
  • Podlasz, P. and Wasowicz, K. (2021): Effect of partial hysterectomy on the neurons of the paracervical ganglion (PCG) of the pig. PLoS One 16, e0245974. https://doi.org/10.1371/journal.pone.0245974.

    • Search Google Scholar
    • Export Citation
  • Reglodi, D., Atlasz, T., Szabo, E., Jungling, A., Tamas, A., Juhasz, T., Fulop, B. D. and Bardosi, A. (2018a): PACAP deficiency as a model of aging. GeroScience 40, 437452. https://doi.org/10.1007/s11357-018-0045-8.

    • Search Google Scholar
    • Export Citation
  • Reglodi, D., Cseh, S., Somoskoi, B., Fulop, B. D., Szentleleky, E., Szegeczki, V., Kovacs, A., Varga, A., Kiss, P., Hashimoto, H., Tamas, A., Bardosi, A., Manavalan, S., Bako, E., Zakany, R. and Juhasz, T. (2018b): Disturbed spermatogenic signaling in pituitary adenylate cyclase activating polypeptide-deficient mice. Reproduction 155, 127137. https://doi.org/10.1530/REP-17-0470.

    • Search Google Scholar
    • Export Citation
  • Reglodi, D., Tamas, A., Koppan, M., Szogyi, D. and Welke, L. (2012): Role of PACAP in female fertility and reproduction at gonadal level – recent advances. Front. Endocrinol. 3, 155. https://doi.org/10.3389/fendo.2012.00155.

    • Search Google Scholar
    • Export Citation
  • Riesco, M. F. and Robles, V. (2013): Cryopreservation causes genetic and epigenetic changes in zebrafish genital ridges. PLoS One 8, e67614. https://doi.org/10.1371/journal.pone.0067614.

    • Search Google Scholar
    • Export Citation
  • Shaw, L., Sneddon, S. F., Brison, D. R. and Kimber, S. J. (2012): Comparison of gene expression in fresh and frozen–thawed human preimplantation embryos. Reproduction 144, 569582. https://doi.org/10.1530/REP-12-0047.

    • Search Google Scholar
    • Export Citation
  • Shioda, S. and Nakamachi, T. (2015): PACAP as a neuroprotective factor in ischemic neuronal injuries. Peptides 72, 202207. https://doi.org/10.1016/j.peptides.2015.08.006.

    • Search Google Scholar
    • Export Citation
  • Somoskői, B., Török, D., Reglodi, D., Tamas, A., Fülöp, B. and Cseh, S. (2020): Possible effects of pituitary adenylate cyclase activating polypeptide (PACAP) on early embryo implantation marker HB-EGF in mouse. Reprod. Biol. 20. https://doi.org/10.1016/j.repbio.2020.01.005.

    • Search Google Scholar
    • Export Citation
  • Takahashi, M. (2012): Oxidative stress and redox regulation on in vitro development of mammalian embryos. J. Reprod. Dev. 58, 19. https://doi.org/10.1262/jrd.11-138n.

    • Search Google Scholar
    • Export Citation
  • Takahashi, M., Keicho, K., Takahashi, H., Ogawa, H., Schultz, R. M. and Okano, A. (2000): Effect of oxidative stress on development and DNA damage in in-vitro cultured bovine embryos by comet assay. Theriogenology 54, 137145. https://doi.org/10.1016/s0093-691x(00)00332-0.

    • Search Google Scholar
    • Export Citation
  • Tanii, I., Aradate, T., Matsuda, K., Komiya, A. and Fuse, H. (2011): PACAP-mediated sperm-cumulus cell interaction promotes fertilization. Reproduction 141, 163171. https://doi.org/10.1530/REP-10-0201.

    • Search Google Scholar
    • Export Citation
  • Török, D., Somoskői, B., Reglődi, D., Tamás, A., Fülöp, B. and Cseh, S. (2018): Effects of hypophysis adenylate cyclase activating polypeptide on female cycle and embryo development in mice-Preliminary results. [In Hungarian], Magy. Allatorvosok 140, 181187.

    • Search Google Scholar
    • Export Citation
  • Vaudry, D., Falluel-Morel, A., Bourgault, S., Basille, M., Burel, D., Wurtz, O., Fournier, A., Chow, B. K. C., Hashimoto, H., Galas, L. and Vaudry, H. (2009): Pituitary adenylate cyclase-activating polypeptide and its receptors: 20 years after the discovery. Pharmacol. Rev. 61, 283357. https://doi.org/10.1124/pr.109.001370.

    • Search Google Scholar
    • Export Citation
  • Watanabe, J., Seki, T. and Shioda, S. (2016): PACAP and neural development. In D. Reglodi and A. Tamas (Eds.), Pituitary Adenylate Cyclase Activating Polypeptide—PACAP (pp. 6582). Springer International Publishing. https://doi.org/10.1007/978-3-319-35135-3_6.

    • Search Google Scholar
    • Export Citation
  • Winters, S. J. and Moore, J. P. (2020): PACAP: a regulator of mammalian reproductive function. Mol. Cell. Endocrinol. 518, 110912. https://doi.org/10.1016/j.mce.2020.110912.

    • Search Google Scholar
    • Export Citation
  • Xu, Z., Ohtaki, H., Watanabe, J., Miyamoto, K., Murai, N., Sasaki, S., Matsumoto, M., Hashimoto, H., Hiraizumi, Y., Numazawa, S. and Shioda, S. (2016): Pituitary adenylate cyclase-activating polypeptide (PACAP) contributes to the proliferation of hematopoietic progenitor cells in murine bone marrow via PACAP-specific receptor. Sci. Rep. 6, 22373. https://doi.org/10.1038/srep22373.

    • Search Google Scholar
    • Export Citation
  • Collapse
  • Expand

Author information is available in PDF.
Please, download the file from HERE.

The manuscript preparation instructions is available in PDF.
Please, download the file from HERE.

Senior editors

Editor-in-Chief: Ferenc BASKA

 

Editorial Board

  • Béla DÉNES (National Food Chain Safety Office, Budapest Hungary)
  • Edit ESZTERBAUER (Veterinary Medical Research Institute, Budapest, Hungary)
  • Hedvig FÉBEL (National Agricultural Innovation Centre, Herceghalom, Hungary)
  • László FODOR (University of Veterinary Medicine, Budapest, Hungary)
  • Balázs HARRACH (Veterinary Medical Research Institute, Budapest, Hungary)
  • Peter MASSÁNYI (Slovak University of Agriculture in Nitra, Nitra, Slovak Republic)
  • Béla NAGY (Veterinary Medical Research Institute, Budapest, Hungary)
  • Tibor NÉMETH (University of Veterinary Medicine, Budapest, Hungary)
  • Zsuzsanna NEOGRÁDY (University of Veterinary Medicine, Budapest, Hungary)
  • Alessandra PELAGALLI (University of Naples Federico II, Naples, Italy)
  • Kurt PFISTER (Ludwig-Maximilians-University of Munich, Munich, Germany)
  • László SOLTI (University of Veterinary Medicine, Budapest, Hungary)
  • József SZABÓ (University of Veterinary Medicine, Budapest, Hungary)
  • Péter VAJDOVICH (University of Veterinary Medicine, Budapest, Hungary)
  • János VARGA (University of Veterinary Medicine, Budapest, Hungary)
  • Štefan VILČEK (University of Veterinary Medicine in Kosice, Kosice, Slovak Republic)
  • Károly VÖRÖS (University of Veterinary Medicine, Budapest, Hungary)
  • Herbert WEISSENBÖCK (University of Veterinary Medicine, Vienna, Austria)
  • Attila ZSARNOVSZKY (Szent István University, Gödöllő, Hungary)

ACTA VETERINARIA HUNGARICA
Institute for Veterinary Medical Research
Centre for Agricultural Research
Hungarian Academy of Sciences
P.O. Box 18, H-1581 Budapest, Hungary
Phone: (36 1) 287 7073 (ed.-in-chief) or (36 1) 467 4081 (editor)

E-mail: actavet@vmri.hu (ed.-in-chief)

Indexing and Abstracting Services:

  • Biological Abstracts
  • BIOSIS Previews
  • CAB Abstracts
  • Chemical Abstracts
  • Current Contents: Agriculture, Biology and Environmental Sciences
  • Elsevier Science Navigator
  • Focus On: Veterinary Science and Medicine
  • Global Health
  • Index Medicus
  • Index Veterinarius
  • Medline
  • Science Citation Index
  • Science Citation Index Expanded (SciSearch)
  • SCOPUS
  • The ISI Alerting Services
  • Zoological Abstracts

 

2022  
Web of Science  
Total Cites
WoS
972
Journal Impact Factor 0.900
Rank by Impact Factor

Veterinary Sciences 95/143

Impact Factor
without
Journal Self Cites
0.900
5 Year
Impact Factor
1.1
Journal Citation Indicator 0.47
Rank by Journal Citation Indicator

Veterinary Sciences 103/170

Scimago  
Scimago
H-index
38
Scimago
Journal Rank
0.277
Scimago Quartile Score

Veterinary (miscellaneous) Q2

Scopus  
Scopus
Cite Score
1.9
Scopus
CIte Score Rank
General Veterinary 76/186 (59th PCTL)
Scopus
SNIP
0.475

2021  
Web of Science  
Total Cites
WoS
1040
Journal Impact Factor 0,959
Rank by Impact Factor Veterinary Sciences 103/144
Impact Factor
without
Journal Self Cites
0,876
5 Year
Impact Factor
1,222
Journal Citation Indicator 0,48
Rank by Journal Citation Indicator Veterinary Sciences 106/168
Scimago  
Scimago
H-index
36
Scimago
Journal Rank
0,313
Scimago Quartile Score Veterinary (miscellaneous) (Q2)
Scopus  
Scopus
Cite Score
1,7
Scopus
CIte Score Rank
General Veterinary 79/183 (Q2)
Scopus
SNIP
0,610

2020  
Total Cites 987
WoS
Journal
Impact Factor
0,955
Rank by Veterinary Sciences 101/146 (Q3)
Impact Factor  
Impact Factor 0,920
without
Journal Self Cites
5 Year 1,164
Impact Factor
Journal  0,57
Citation Indicator  
Rank by Journal  Veterinary Sciences 93/166 (Q3)
Citation Indicator   
Citable 49
Items
Total 49
Articles
Total 0
Reviews
Scimago 33
H-index
Scimago 0,395
Journal Rank
Scimago Veterinary (miscellaneous) Q2
Quartile Score  
Scopus 355/217=1,6
Scite Score  
Scopus General Veterinary 73/183 (Q2)
Scite Score Rank  
Scopus 0,565
SNIP  
Days from  145
submission  
to acceptance  
Days from  150
acceptance  
to publication  
Acceptance 19%
Rate

 

2019  
Total Cites
WoS
798
Impact Factor 0,991
Impact Factor
without
Journal Self Cites
0,897
5 Year
Impact Factor
1,092
Immediacy
Index
0,119
Citable
Items
59
Total
Articles
59
Total
Reviews
0
Cited
Half-Life
9,1
Citing
Half-Life
9,2
Eigenfactor
Score
0,00080
Article Influence
Score
0,253
% Articles
in
Citable Items
100,00
Normalized
Eigenfactor
0,09791
Average
IF
Percentile
42,606
Scimago
H-index
32
Scimago
Journal Rank
0,372
Scopus
Scite Score
335/213=1,6
Scopus
Scite Score Rank
General Veterinary 62/178 (Q2)
Scopus
SNIP
0,634
Acceptance
Rate
18%

 

Acta Veterinaria Hungarica
Publication Model Hybrid
Submission Fee none
Article Processing Charge 1100 EUR/article
Printed Color Illustrations 40 EUR (or 10 000 HUF) + VAT / piece
Regional discounts on country of the funding agency World Bank Lower-middle-income economies: 50%
World Bank Low-income economies: 100%
Further Discounts Editorial Board / Advisory Board members: 50%
Corresponding authors, affiliated to an EISZ member institution subscribing to the journal package of Akadémiai Kiadó: 100%
Subscription fee 2023 Online subsscription: 732 EUR / 892 USD
Print + online subscription: 848 EUR / 1028 USD
Subscription Information Online subscribers are entitled access to all back issues published by Akadémiai Kiadó for each title for the duration of the subscription, as well as Online First content for the subscribed content.
Purchase per Title Individual articles are sold on the displayed price.

Acta Veterinaria Hungarica
Language English
Size A4
Year of
Foundation
1951
Volumes
per Year
1
Issues
per Year
4
Founder Magyar Tudományos Akadémia
Founder's
Address
H-1051 Budapest, Hungary, Széchenyi István tér 9.
Publisher Akadémiai Kiadó
Publisher's
Address
H-1117 Budapest, Hungary 1516 Budapest, PO Box 245.
Responsible
Publisher
Chief Executive Officer, Akadémiai Kiadó
ISSN 0236-6290 (Print)
ISSN 1588-2705 (Online)

Monthly Content Usage

Abstract Views Full Text Views PDF Downloads
Sep 2023 0 161 96
Oct 2023 0 407 41
Nov 2023 0 102 33
Dec 2023 0 121 30
Jan 2024 0 93 25
Feb 2024 0 155 15
Mar 2024 0 0 0