Abstract
Rodents (Mammalia: Rodentia) are among the ubiquitous hosts of Giardia duodenalis, as they can harbour at least six assemblages of this species, including the zoonotic assemblages A and B. However, studies targeting a broad spectrum of rodents and rabbits sampled in the same region are scarce, even in Europe. During this study, 164 samples were collected from five rodent species and rabbits in five locations in Hungary, to examine the presence of G. duodenalis with traditional parasitological and molecular methods. Parasitological analysis revealed the presence of cysts in 58.3% of asymptomatic Norway rats and 27.6% of chinchillas. Three degus were also found Giardia-infected (prevalence: 16.7%) using flotation technique. With PCR targeting three genetic markers, 3.2% of the samples showed positivity, whereas a rate of 21.9% prevalence was detected with flotation. The PCR products of five samples could be DNA sequenced. Phylogenetic analysis based on the partial sequences of the beta-giardin gene revealed the presence of assemblages B and G in rats. In addition, assemblage E was detected in a beaver, while assemblage B was present in a chinchilla. The results show that synanthropic rodent species have different epidemiological roles in the study region, depending on the prevalence of shedding Giardia cysts or harbouring zoonotic variants of G. duodenalis. Moreover, our findings confirm that pet rodents may pose a risk for zoonotic Giardia-transmission.
Introduction
Giardia species (Metamonada: Diplomonadida) are flagellate protozoan parasites that infect a broad range of vertebrate hosts and are ubiquitous in mammals worldwide (Monis et al., 2003; Cacciò and Ryan, 2008). They have two developmental stages: (1) the cyst that is ingested by the host, usually with drinking water or food giving rise to (2) the trophozoite that will multiply epicellularly on the small intestinal mucosa. The latter way of parasitism may entail pathological consequences, such as villous atrophy, malabsorption and diarrhoea, but a high ratio of Giardia-infections remain asymptomatic (Cacciò and Ryan, 2008).
Currently, there are eight Giardia species recognized (Lyu et al., 2018). Among these, from a veterinary-medical point of view, the most important is Giardia duodenalis, which is the only species infecting humans, although various mammalian hosts, including pets and livestock, are also susceptible (Cacciò et al., 2018). For more than two decades, increasing amount of data attests that G. duodenalis should be considered as a species complex, members of which show little morphological variation but are genetically distinct enough to be assigned to nine distinct assemblages (A–I) (Baruch et al., 1996; Monis et al., 2003; Wielinga et al., 2023; unpublished sequence in GenBank: MT317150). These assemblages have been proposed to deserve taxonomic revision as separate species (Wielinga et al., 2023).
Considering the hosts of the main assemblages within G. duodenalis, rodents appear to predominate (Cai et al., 2021). They can harbour at least six assemblages, including the zoonotic A and B, as well as the rodent-specific assemblage G and assemblage E from livestock (Vioque et al., 2022). Moreover, rodents are the only hosts of G. duodenalis that can be found close to humans in both rural and urban areas as synanthropic wild animals and pets (Veronesi et al., 2012; Cervero-Aragó et al., 2021).
Despite this, studies on the prevalence and genetic diversity of G. duodenalis infecting various species of rodents are less frequently reported than those involving single species of other synanthropic mammals, such as dogs or cattle. This is in part due to the fact that rodents tend to harbour another species, Giardia muris, more frequently than G. duodenalis (Helmy et al., 2018). On the other hand, genotyping is not always successful in small mammals (Vioque et al., 2022). Nevertheless, importance of this topic is well illustrated by the nomenclature of the disease caused by G. duodenalis in humans, as it is frequently referred to as “beaver fever” on account of beavers passing cysts of zoonotic genotypes into water (Tsui et al., 2018).
In Europe, only a limited number of reports are available on the prevalence and genotypes of G. duodenalis in small mammals, some of them targeting wild rodents (Adriana et al., 2016; Helmy et al., 2018) others sampling pet rodents (Veronesi et al., 2012; Gherman et al., 2018). At the same time, while beavers appear to be repeatedly investigated in this context in North America (e.g., Fayer et al., 2006), there appears to be only one relevant report from Europe (Sroka et al., 2015). Therefore, this study aimed at compensating for this scarcity of data in and near the Carpathian Basin, i.e., screening Giardia-infection in rodents: the degus (Octodon degus), the chinchilla (Chinchilla lanigera), the Norway rat (Rattus norvegicus), the guinea pig (Cavia porcellus) and the beaver (Castor fiber), as well as a lagomorph, the domestic rabbit (Oryctolagus cuniculus var. domestica) with a traditional parasitological method (flotation) and further evaluation of positive samples with molecular biological tools.
Materials and methods
Sample collection and parasitological screening
In this study, 27 intestinal contents and 137 faecal samples (164 samples in total) of five rodent species and rabbits were included (Table 1). Most samples were collected from small mammals that were rescued or found dead due to natural causes, as well as from patients of exotic pet clinics, sampled during regular veterinary care between 2022 and 2023 in Budapest (sampling site “d”) and Komárom (sampling site “e”), Hungary (Fig. 1). Faecal samples were stored for a maximum of four days at 2–6 °C before processing. All available relevant clinical data (i.e., anamnesis) were recorded. In addition, contents of the small (n = 12) and large intestine (n = 15) were removed from beavers that were caught as part of an official campaign, to reduce their populations (Szekeres et al., 2022). Ethical permissions were issued by the local county authorities: (a) Győr-Moson-Sopron (14178–10/2016, 88–4/2018, GY-02/TV/00293–7/2019); (b) Jász-Nagykun-Szolnok (JN 07/61/01703–2019, JN/07/61/00079–69/2018, PE/KTFO/5519–11/2019); (c) Zala (ZA/KTF/00092–7/2020); (d) Budapest (e) Komárom.
Host species and results of parasitological and molecular evaluation of intestinal (n = 27) and faecal (n = 137) samples tested for the presence of Giardia
| Host species | Number of samples examined (n = 164 in total) | Number and rate of Giardia-positive samples based on flotation | Results of molecular analyses | |
| Number and % of PCR-positives (gene) | Assemblage if successfully sequenced (accession number) | |||
| rat (Rattus norvegicus) | 12 | 7 (58.3%) | 3 (25.0%) (bg) | B (PP481180), 2× G (PP481181) |
| chinchilla (Chinchilla lanigera) | 76 | 21 (27.6%) | 1 (1.3%) (tpi) | B (PP501011) |
| guinea pig (Cavia porcellus) | 10 | 0 | ND | ND |
| degu (Octodon degus) | 12 | 2 (16.7%) | 0 | – |
| beaver (Castor fiber) | 27 | ND | 1 (3.7%) (gdh) | E (PP501010) |
| rabbit (Oryctolagus cuniculus var. domestica) | 27 | 0 | ND | ND |
ND – not done; tpi – triosephosphate isomerase; bg – beta-giardin; gdh – NADP-glutamate dehydrogenase; B – Assemblage B; G – Assemblage G; E – Assemblage E.
The origin of rodents and lagomorphs tested in the study. (a) Győr-Moson-Sopron county (Hegykő) 3 European beavers (Castor fiber) (b) Jász-Nagykun-Szolnok county (Jásztelek and Jászsági main channel) 6 European beavers (Castor fiber) (c) Zala county (Szentpéterfölde) 6 European beavers (Castor fiber) (d) Budapest [12 chinchillas (Chinchilla lanigera); 2 degus (Octodon degus); 22 rabbits (Oryctolagus cuniculi); 12 Norway rats (Rattus norvegicus); 10 guinea pigs (Cavia porcellus)] (e) Komárom-Esztergom county (Komárom) 11 chinchillas. 68 faecal samples (of 137 faecal samples in total) from 10 degus, 53 chinchillas and 5 domestic rabbits have no location data
Citation: Acta Veterinaria Hungarica 73, 1; 10.1556/004.2024.01115
Screening for the presence of Giardia cysts was performed for all samples, except for beaver gut contents (all of which were included in molecular analyses). This involved soaking of 3 g faeces in 10 mL 0.9% sodium chloride solution for 10–15 min, then flotation in 1,200 g*L−1 ZnSO4 solution at 3,000 rpm for 5 min with a Megafuge 8 centrifuge (Thermo Fisher Scientific, Budapest Hungary). Evaluation of the presence of cysts was done using a Leica DM 2000 light microscope (Leica Microsystems, Wetzlar, Germany) with 400× magnification.
DNA extraction
Prior to DNA extraction, 1 g of samples were soaked in 0.9% sodium chloride solution according to the method mentioned above, then filtered. DNA was extracted from all Giardia cyst-containing samples and all beaver samples using the QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions with one modification. In particular, during the incubation with InhibitEX Buffer, faecal samples were subjected to three freeze-thaw cycles including freezing at −80 °C for overnight, followed by prolonged incubation at room temperature. DNA extracts were stored at −20 °C until molecular analysis by conventional PCRs.
Nested-PCR (nPCR), sequencing and phylogenetic analysis
All samples from beavers and Giardia-positive samples from other species were investigated for the following three genetic markers: the glutamate dehydrogenase (gdh), the beta-giardin (bg) and the triosephosphate isomerase (tpi) genes. The nPCRs were performed as reported by Cacciò et al. (2008), Gillhuber et al. (2013), using 1 µL of template DNA from the first-round PCR. In all cases, the amplification was done in a T100 Thermal Cycler (Bio-Rad, California, US) in a final volume of 25 µL using 2× Red PCR Master mix (Rovalab, Teltow, Germany) and 10 µM of each primer (GeneriBiotech, Hradec Králové, Czech Republic). The amplification conditions, target genes and primers are shown in Table 2.
Molecular methods used for the detection of Giardia duodenalis in intestinal and faecal samples of rodents and rabbit: nested PCR primers and cycling conditions according to target genes (tpi: triosephosphate isomerase; bg: beta-giardin; gdh: NADP-glutamate dehydrogenase)
| Gene name | Amplicon length (bp) | Primer names | Primer sequences (5′…′3) | PCR conditions | References |
| bg | 753 | G7 | AAGCCCGACGACCTCACCCGCAGTGC | 1 cycle: 95 °C for 5 min; 40 cycles: 95 °C for 45 s, 50 °C for 30 s, 72 °C for 60 s; 1 cycle: 72 °C for 7 min | Gillhuber et al. (2013) |
| G759 | GAGGCCGCCCTGGATCTTCGAGACGAC | ||||
| 511 | B-F | GAACGAACGAGATCGAGGTCCG | 1 cycle: 95 °C for 5 min; 35 cycles: 95 °C for 45 s, 55 °C for 30 s, 72 °C for 45 s; 1 cycle: 72 °C for 7 min | ||
| B-R | CTCGACGAGCTTCGTGTT | ||||
| gdh | n.s. | GDHeF | TCAACGTYAAYCGYGGYTTCCGT | 1 cycle: 95 °C for 5 min; 40 cycles: 95 °C for 45 s, 50 °C for 30 s, 72 °C for 60 s; 1 cycle: 72 °C for 7 min | |
| GDHeR | GTTRTCCTTGCACATCTCC | ||||
| 432 | GDHiF | CAGTACAACTCYGCTCTCGG | 1 cycle: 95 °C for 5 min; 40 cycles: 95 °C for 45 s, 60 °C for 30 s, 72 °C for 45 s; 1 cycle: 72 °C for 7 min | ||
| GDHiR | GTTRTCCTTGCACATCTCC | ||||
| tpi | 605 | ALA3542 | AAATIATGCCTGCTCGTCG | 1 cycle: 95 °C for 5 min; 40 cycles: 95 °C for 45 s, 50 °C for 30 s, 72 °C for 60 s; 1 cycle: 72 °C for 7 min | Cacció et al. (2008) |
| ALA3542 | CAAACCTTITCCGCAAACC | ||||
| 530 | ALA3544 | CCCTTCATCGGIGGTAACTT | |||
| ALA3545 | GTGGCCACCACICCCGTGCC |
n.s. – not specified.
Positive and negative controls were included in each PCR reaction set. For the visualization of PCR products, 1.5% agarose gel was used, stained with SYBR Safe DNA gel stain (Invitrogen, California, USA). PCR products of Giardia-positive samples were purified using QIAquick PCR purification kit (Qiagen, Hilden, Germany) and Sanger-sequenced at Macrogen Europe (Amsterdam, Netherlands). Nucleotide sequences were analysed using Basic Local Alignment Search Tool (BLAST) and aligned with homologous sequences available in GenBank.
New sequences were submitted to GenBank (accession numbers: PP481180-PP481181 for the bg gene, PP501010 for the gdh and PP501011 for the tpi genes). The dataset, including sequences from this study and those retrieved from GenBank, was resampled 1,000 times to generate bootstrap values. Phylogenetic analyses based on partial bg gene sequences were conducted with the Maximum Likelihood method and General Time Reversible (GTR) model using MEGA 11.0 (Tamura et al., 2021).
Results
The parasitological screening revealed the presence of cysts in 58.3% (7 of 12) asymptomatic Norway rats, as well as in 27.6% (21 of 76) of chinchillas, including two with diarrhoea. Two degus were also Giardia-infected (prevalence: 16.7%), one showing diarrhoea (Table 1). The flotation revealed only a low number of cysts in the great majority of rodents with positive results, only one rat having relatively high numbers. On the other hand, no Giardia cysts were found in any samples of guinea pigs or domestic rabbits of this study (Table 1).
PCRs targeting three genetic markers yielded sufficient amount of PCR product for DNA sequencing only in case of a few cyst-shedding rodents (Table 1). Based on the bg gene, assemblage B (NCBI acc. No. PP481180) was identified in one, and assemblage G (PP481181) in two rats (Table 1). This assignment was confirmed by their phylogenetic clustering (Fig. 2). On the other hand, a part of the gdh gene of assemblage E (PP501010) was successfully amplified from the content of a beaver's small intestine. This genotype was 100% (274/274 bp) identical only to G. duodenalis assemblage E (isolate 6L) reported form sheep in Spain (JF792403). In addition, the tpi gene sequence of G. duodenalis assemblage B (PP501011) was detected in one chinchilla. This had 100% (457/457 bp) identity with isolate IRU20 reported from a human being in Iran (MH310971).
Phylogenetic tree of Giardia duodenalis sequences based on the beta-giardin (bg) gene, using the Maximum Likelihood method and the General Time Reversible (GTR) model. In each row, after the species or genus name, the generic name of the isolation source and the GenBank accession number are shown. Sequences obtained in this study are in red and bold accession numbers. A mouse silhouette placed on the main branch of an assemblage indicates that it was reported to occur in rodents. There were 413 positions in the final dataset. The scale-bar indicates the number of substitutions per site. Numbers at nodes represent the percentage of bootstrap values
Citation: Acta Veterinaria Hungarica 73, 1; 10.1556/004.2024.01115
Discussion
This study investigated the presence and assemblages of G. duodenalis in six species of small mammals, some of which were targeted in this context for the first time in the Carpathian Basin. Emphasizing the importance of similar studies, previous data attest the high veterinary-medical significance of rodents in the epidemiology of giardiosis. These small mammals have been reported to carry the highest diversity of assemblages (up to four in a single study: Levecke et al., 2011), and the zoonotic A and B have been demonstrated in the highest ratio based on either the number of rodent species (Cai et al., 2021) or considering the overall prevalence of infection across different studies (Egan et al., 2024).
In this survey, the highest prevalence of infection with G. duodenalis, and two assemblages (B and G) were found in rats. These findings confirm that apart from G. muris and assemblage G, zoonotic genotypes of G. duodenalis may also occur in this host. Previously, the following rat-associated assemblages were reported: in Southern Europe (Spain: up to 36% prevalence, assemblages B, G by Fernández-Álvarez et al., 2014), in Central Europe (Austria: 34% prevalence, assemblages A, G by Cervero-Aragó et al., 2021) and in Northern Europe (Sweden: assemblage G by Lebbad et al., 2010) suggesting that urban and rural rat populations carry this protozoan parasite (including its zoonotic variants) with high prevalence. This is especially important in the era of urbanization when rat populations and associated disease risks show a rising tendency in several parts of Europe (e.g., de Cock et al., 2023).
In Europe, pet chinchillas could carry a broad range of G. duodenalis genotypes, including the zoonotic assemblages A (in Belgium: Levecke et al., 2011) and B (in Belgium: Levecke et al., 2011; in Italy: Veronesi et al., 2012; in Romania: Gherman et al., 2018; in Czechia: Lecová et al., 2020). In addition, the following assemblages have been reported from this host: assemblage D (in Romania: Gherman et al., 2018), C (in Belgium: Levecke et al., 2011; in Italy: Veronesi et al., 2012) and assemblage E (in Belgium: Levecke et al., 2011; in Romania: Gherman et al., 2018). In most studies assemblage B have been demonstrated from chinchillas either solely (Lecová et al., 2020), or as the predominant genotype (Levecke et al., 2011; Veronesi et al., 2012; Gherman et al., 2018). In one of these studies, each Giardia-positive chinchilla was infected with at least one of the two zoonotic assemblages (A and/or B), underlining the potential risks associated with these pet rodents in human infection (Levecke et al., 2011).
It was also shown here that pet degus may shed Giardia cysts. Unfortunately, the corresponding genotype could not be identified from this host species, probably because of the low number of cysts, which prevented the extraction of sufficient DNA, as also reported in other studies (Veronesi et al., 2012). Nevertheless, to our knowledge, this is the first report on the Giardia-carrier status of pet degus based on a regular parasitological laboratory method. Previously, infection with this parasite was either not detected in pet degus (Jekl et al., 2011), or only with highly sensitive immunological method (Najecki and Tate, 1999). These results suggest that (especially compared to chinchillas) degus are less important hosts of G. duodenalis and play a subordinate role in its zoonotic transmission.
Assemblage E was detected in beavers for the first time, although it has been reported previously in other rodent species, including chinchillas (Levecke et al., 2011). Beavers frequently shed zoonotic A and B assemblages of G. duodenalis during their water-associated life, and they have been found responsible for human infections in North America, where people had access to (bathing in or drinking) water downstream (Fayer et al., 2006; Heyworth, 2016; Tsui et al., 2018). This has also been confirmed by a European study, where assemblages A and B were found in this host (in Poland: Sroka et al., 2015). Although, based on our preliminary results, a similar epidemiological role could not be established in the southern part of Central Europe, this situation deserves continuous monitoring, because of the increasing beaver populations throughout Europe (Serva et al., 2023).
On the other hand, no rabbits and guinea pigs were found to carry G. duodenalis in this study. Similarly, previous reports on Giardia-positivity of guinea pigs could not confirm infection in these pet rodents (e.g., d’Ovidio et al., 2015; Wang et al., 2022), or the prevalence was low (Pantchev et al., 2014). Thus, based on our results, the role of these hosts in terms of zoonotic transmission appears to be negligible in the examined population. This is in line with a previous large scale study involving samples from Germany and other European countries, where chinchillas had significantly higher prevalence of Giardia-infection than rabbits and guinea pigs (Pantchev et al., 2014).
In conclusion, findings of this study support that synanthropic rodent species are not equally important in their epidemiological role with respect to shedding Giardia cysts; especially when focusing on the question whether a zoonotic assemblage is involved in their infection. The majority of animals tested here were asymptomatic carriers, further increasing the necessity of awareness that clinically normal pet rodents may pose a risk of shedding cysts of even zoonotic Giardia genotypes (most likely from assemblage B).
Acknowledgements
This study was funded by Project no. TKP2020-NKA-01 implemented with the support provided from the National Research, Development and Innovation Fund of Hungary, financed under the “Tématerületi Kiválósági Program 2020” (2020-4.1.1-TKP2020) funding scheme, and under EFOP-3.6.3.-VEKOP-16-2017-00005. Molecular work was also supported by the Hungarian Research Network (HUN-REN), Hungary (Project No. 1500107).
References
Adriana, G., Zsuzsa, K., Mirabela Oana, D., Mircea, G. C. and Viorica, M. (2016): Giardia duodenalis genotypes in domestic and wild animals from Romania identified by PCR-RFLP targeting the gdh gene. Vet. Parasitol. 217, 71–75. https://doi.org/10.1016/j.vetpar.2015.10.017.
Baruch, A. C., Isaac-Renton, J. and Adam, R. D. (1996): The molecular epidemiology of Giardia lamblia: a sequence-based approach. J. Infect. Dis. 174, 233–236. https://doi.org/10.1093/infdis/174.1.233.
Cacciò, S. M., Beck, R., Lalle, M., Marinculic, A. and Pozio, E. (2008): Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B. Int. J. Parasitol. 38, 1523–1531. https://doi.org/10.1016/j.ijpara.2008.04.008.
Cacciò, S. M., Lalle, M. and Svärd, S. G. (2018): Host specificity in the Giardia duodenalis species complex. Infect. Genet. Evol. 66, 335–345. https://doi.org/10.1016/j.meegid.2017.12.001.
Cacciò, S. M. and Ryan, U. (2008): Molecular epidemiology of giardiasis. Mol. Biochem. Parasitol. 160, 75–80. https://doi.org/10.1016/j.molbiopara.2008.04.006.
Cai, W., Ryan, U., Xiao, L. and Feng, Y. (2021): Zoonotic giardiasis: an update. Parasitol. Res. 120, 4199–4218. https://doi.org/10.1007/s00436-021-07325-2.
Cervero-Aragó, S., Desvars-Larrive, A., Lindner, G., Sommer, R., Häfeli, I. and Walochnik, J. (2021): Surface waters and urban Brown rats as potential sources of human-infective Cryptosporidium and Giardia in Vienna, Austria. Microorganisms. 9, 1596. https://doi.org/10.3390/microorganisms9081596.
d’Ovidio, D., Noviello, E., Ianniello, D., Cringoli, G. and Rinaldi, L. (2015): Survey of endoparasites in pet guinea pigs in Italy. Parasitol. Res. 114, 1213–1216. https://doi.org/10.1007/s00436-014-4289-7.
de Cock, M. P., de Vries, A., Fonville, M., Esser, H. J, Mehl, C., Ulrich, R. G., Joeres, M., Hoffmann, D., Eisenberg, T., Schmidt, K., Hulst, M., van der Poel, W. H. M., Sprong, H. and Maas, M. (2023): Increased rat-borne zoonotic disease hazard in greener urban areas. Sci. Total Environ. 896, 165069. https://doi.org/10.1016/j.scitotenv.2023.165069.
Egan, S., Barbosa, A. D., Feng, Y., Xiao, L. and Ryan, U. (2024): Critters and contamination: zoonotic protozoans in urban rodents and water quality. Water Res. 251, 121165. https://doi.org/10.1016/j.watres.2024.121165.
Fayer, R., Santín, M., Trout, J. M., DeStefano, S., Koenen, K. and Kaur, T. (2006): Prevalence of Microsporidia, Cryptosporidium spp., and Giardia spp. in beavers (Castor canadensis) in Massachusetts. J. Zoo Wildl. Med. 37, 492–497. https://doi.org/10.1638/06-013.1.
Fernández-Álvarez, Á., Martín-Alonso, A., Abreu-Acosta, N., Feliu, C., Hugot, J. P., Valladares, B. and Foronda P. (2014): Identification of a novel assemblage G subgenotype and a zoonotic assemblage B in rodent isolates of Giardia duodenalis in the Canary Islands, Spain. Parasitology 141, 206–215. https://doi.org/10.1017/S003118201300139X.
Gherman, C. M., Kalmár, Z., Györke, A. and Mircean, V. (2018): Occurrence of Giardia duodenalis assemblages in farmed long-tailed chinchillas Chinchilla lanigera (Rodentia) from Romania. Parasites Vectors 11, 86. https://doi.org/10.1186/s13071-018-2652-8.
Gillhuber, J., Pallant, L., Ash, A., Thompson, R. C., Pfister, K. and Scheuerle, M. C. (2013): Molecular identification of zoonotic and livestock-specific Giardia-species in faecal samples of calves in Southern Germany. Parasites Vectors 6, 346. https://doi.org/10.1186/1756-3305-6-346.
Helmy, Y. A., Spierling, N. G., Schmidt, S., Rosenfeld, U. M., Reil, D., Imholt, C., Jacob, J., Ulrich, R. G., Aebischer, T. and Klotz, C. (2018): Occurrence and distribution of Giardia species in wild rodents in Germany. Parasites & Vectors. 11, 213. https://doi.org/10.1186/s13071-018-2802-z.
Heyworth, M. F. (2016): Giardia duodenalis genetic assemblages and hosts. Parasite 23, 13. https://doi.org/10.1051/parasite/2016013.
Jekl, V., Hauptman, K. and Knotek, Z. (2011): Diseases in pet degus: a retrospective study in 300 animals. J. Small Anim. Pract. 52, 107–112. https://doi.org/10.1111/j.1748-5827.2010.01028.x.
Lebbad, M., Mattsson, J. G., Christensson, B., Ljungström, B., Backhans, A., Andersson, J. O. and Svärd S. G. (2010): From mouse to moose: multilocus genotyping of Giardia isolates from various animal species. Vet. Parasitol. 168, 231–239. https://doi.org/10.1016/j.vetpar.2009.11.003.
Lecová, L., Hammerbauerová, I., Tůmová, P. and Nohýnková, E. (2020): Companion animals as a potential source of Giardia intestinalis infection in humans in the Czech Republic - a pilot study. Vet. Parasitol. Reg. Stud. Reports. 21, 100431. https://doi.org/10.1016/j.vprsr.2020.100431.
Levecke, B., Meulemans, L., Dalemans, T., Casaert, S., Claerebout, E. and Geurden, T. (2011): Mixed Giardia duodenalis assemblage A, B, C and E infections in pet chinchillas (Chinchilla lanigera) in Flanders (Belgium). Vet. Parasitol. 177, 166–170. https://doi.org/10.1016/j.vetpar.2010.11.027.
Lyu, Z., Shao, J., Xue, M., Ye, Q., Chen, B., Qin, Y. and Wen, J. (2018): A new species of Giardia Künstler, 1882 (Sarcomastigophora: Hexamitidae) in hamsters. Parasites & Vectors .11, 202. https://doi.org/10.1186/s13071-018-2786-8.
Monis, P. T., Andrews, R. H., Mayrhofer, G. and Ey, P. L. (2003): Genetic diversity within the morphological species Giardia intestinalis and its relationship to host origin. Infect Genet. Evol .3, 29–38. https://doi.org/10.1016/S1567-1348(02)00149-1.
Najecki, D. and Tate, B. (1999): Husbandry and management of the degu. Lab Anim. 28, 54–62.
Pantchev, N., Broglia, A., Paoletti, B., Globokar Vrhovec, M., Bertram, A., Nöckler, K. and Cacciò, S. M. (2014): Occurrence and molecular typing of Giardia isolates in pet rabbits, chinchillas, Guinea pigs and ferrets collected in Europe during 2006–2012. Vet. Rec. 175, 18. https://doi.org/10.1136/vr.102236.
Serva, D., Biondi, M. and Iannella, M. (2023): The Eurasian beaver range expansion reveals uneven future trends and possible conservation issues: an European assessment. Biodivers Conserv. 32, 1999–2016. https://doi.org/10.1007/s10531-023-02587-x.
Sroka, J., Giżejewski, Z., Wójcik-Fatla, A., Stojecki, K., Bilska - Zając, E., Dutkiewicz, J., Cencek, T., Karamon, J., Zając, V., Kusyk, P., Dąbrowska, J. and Kochanowski, M. (2015): Potential role of beavers (Castor fiber) in contamination of water in the Masurian Lake District (north-eastern Poland) with protozoan parasites Cryptosporidium spp. and Giardia duodenalis. J. Vet. Res. 59, 219–228. https://doi.org/10.1515/bvip-2015-0033.
Szekeres, S., Czabán, D., Takács, N., Széll, Z., Gubányi, A., Kontschán, J., Hornok, S. and Sréter, T. (2022): First report of molecular taxonomic analyses of European beaver metazoan parasites from Hungary. Parasitol. Res. 121, 1895–1902. https://doi.org/10.1007/s00436-022-07547-y.
Tamura, K., Stecher, G. and Kumar, S. (2021): MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 38(7), 3022–3027. https://doi.org/10.1093/molbev/msab120.
Tsui, CK-M., Miller, R., Uyaguari-Diaz, M., Tang, P., Chauve, C., Hsiao, W., Isaac-Renton, J. and Prystajecky, N. (2018): Beaver fever: whole-genome characterization of waterborne outbreak and sporadic isolates to study the zoonotic transmission of giardiasis. mSphere 3, e00090-18. https://doi.org/10.1128/msphere.00090-18.
Veronesi, F., Piergili Fioretti, D., Morganti, G., Bietta, A., Moretta, I., Moretti, A. and Traversa, D. (2012): Occurrence of Giardia duodenalis infection in chinchillas (Chincilla lanigera) from Italian breeding facilities. Res. Vet. Sci. 93, 807–810. https://doi.org/10.1016/j.rvsc.2011.12.019.
Vioque, F., Dashti, A., Santín, M., Ruiz-Fons, F., Köster, P. C., Hernández-Castro, C., García, J. T., Bailo, B., Ortega, S., Olea, P. P., Arce, F., Chicharro, C., Nieto, J., González, F., Viñuela, J., Carmena, D. and González-Barrio, D. (2022): Wild micromammal host spectrum of zoonotic eukaryotic parasites in Spain. Occurrence and genetic characterisation. Transbound. Emerg. Dis. 69, e2926–e2942. https://doi.org/10.1111/tbed.14643.
Wang, N., Wang, K., Liu, Y., Zhang, X., Zhao, J., Zhang, S. and Zhang, L. (2022): Molecular characterization of Cryptosporidium spp., Enterocytozoon bieneusi and Giardia duodenalis in laboratory rodents in China. Parasite 29, 46. https://doi.org/10.1051/parasite/2022046.
Wielinga, C., Williams, A., Monis, P. and Thompson, R. C. A. (2023): Proposed taxonomic revision of Giardia duodenalis. Infect Genet. Evol. 111, 105430. https://doi.org/10.1016/j.meegid.2023.105430.
