Full access

Background and aims

Betony (Betonica officinalis L.) is one of the rarest and most spectacular plants in the Scandinavian flora. A long-term question has been whether it is spontaneous or introduced, or whether it comprises both spontaneous and introduced populations. This study aimed to answer this question by analyzing sequence data from the nuclear external transcribed spacer (ETS) region and three regions of the plastid genome, the trnT–trnL intergenic spacer (IGS) region, tRNA-Leu (trnL) intron, and the trnS–trnG IGS.

Materials and methods

Altogether 41 samples from 11 European countries were analyzed. A unique duplication in the trnT–trnL IGS was detected in material from Skåne (southern Sweden), the “Skåne-duplication.” Populations with this duplication are united on a moderately supported branch in the phylogeny based on plastid sequences. A distinct heath genotype from Yorkshire was discovered in the phylogeny based on plastid sequences and in a comparative cultivation.

Results

Phylogeny based on ETS sequences does not support any Scandinavian group, whereas a principal coordinates analysis ordination based on variable ETS positions indicated a spontaneous origin for all Scandinavian populations, which comprise a genetically well-defined subgroup of the species, most closely related to other spontaneous populations from adjacent parts of continental parts of northern Europe.

Discussion

Seven possible naturally occurring localities remain in Scandinavia, five in central Skåne, southernmost Sweden, and two on the southwestern part of the Danish island of Lolland.

Abstract

Background and aims

Betony (Betonica officinalis L.) is one of the rarest and most spectacular plants in the Scandinavian flora. A long-term question has been whether it is spontaneous or introduced, or whether it comprises both spontaneous and introduced populations. This study aimed to answer this question by analyzing sequence data from the nuclear external transcribed spacer (ETS) region and three regions of the plastid genome, the trnT–trnL intergenic spacer (IGS) region, tRNA-Leu (trnL) intron, and the trnS–trnG IGS.

Materials and methods

Altogether 41 samples from 11 European countries were analyzed. A unique duplication in the trnT–trnL IGS was detected in material from Skåne (southern Sweden), the “Skåne-duplication.” Populations with this duplication are united on a moderately supported branch in the phylogeny based on plastid sequences. A distinct heath genotype from Yorkshire was discovered in the phylogeny based on plastid sequences and in a comparative cultivation.

Results

Phylogeny based on ETS sequences does not support any Scandinavian group, whereas a principal coordinates analysis ordination based on variable ETS positions indicated a spontaneous origin for all Scandinavian populations, which comprise a genetically well-defined subgroup of the species, most closely related to other spontaneous populations from adjacent parts of continental parts of northern Europe.

Discussion

Seven possible naturally occurring localities remain in Scandinavia, five in central Skåne, southernmost Sweden, and two on the southwestern part of the Danish island of Lolland.

Introduction

Betony (Betonica officinalis L.) has the longest documented history of all Scandinavian plant species. The history began almost 500 years ago, when the Danish humanist Christiern Pedersen (c. 1480–1554) in his book Om Urte Vand [On plant extracts] reported that “betony grows here in Skåne, in particular in Stod hage” [Stehag] (Pedersen, 1534, p. 21). His published note on betony was the first from the province Skåne, at that time a part of Denmark, and probably one of the earliest records in the world where a locality is connected with a plant species.

Betony may have been found locally frequent in western central Skåne in medieval times but was considered extinct from Skåne during the period 1770–1820 (Fries, 1823; Lilja, 1870, p. 403). In Stehag, the locality reported by Pedersen, it was not observed during two periods, 1740–1860 and 1957–1977 (Thell, 2016b). Leche (1744, p. 10) had found it “on meadows at Stehag” in 1740, and “on a meadow close to Lund and at Maglö farm” (Linnæus, 1745, p. 176, 1755, p. 201). The population in Maglö in Norra Mellby parish in northern central Skåne went extinct early (Lilja, 1838, p. 253; Thell, 2016a, 2016b). After Leche’s reports, it was not collected in Stehag until 1860 (Sandberg LD1157437). Twelve additional herbarium sheets from Stehag are stored in the Lund University botanical collections (LD). The most recent addition was collected in 1925; thereafter, betony became very rare. Forested meadows, the preferred habitat, were formerly frequent west of Stehag, but were transferred to settled areas or spruce forests and earlier into agricultural land. Both Weverinck (1939, p. 49) and Rufelt (1949, p. 113) mention “a single, fenced population of betony just south of the railway station,” perhaps the place where the last plant was removed to a private garden in 1957 prior to the building process of the water supply station, finished in 1963. A small betony plant with few inflorescences was discovered in 1977 (Larsson, 1987, p. 111). The next observations were in 1980 (Karlsson, 1982, p. 81), again a single plant, and in 1985–1986 when 15 plants in 6 places were counted (Larsson, 1987, p. 111). In 1980, it was discovered in Kastberga in Västra Sallerup about 3 km southwest of Stehag (Larsson, 1987, p. 111).

At present, about 20 specimens of B. officinalis are growing in Stehag; however, about half of them may be the result of vegetative spreading. Two localities are positioned in Västra Sallerup, where about 25 individuals grow in Kastberga forest and 6 or 7 plants on Kastberga meadow around 500 m to the northwest. A population of 17–19 individuals grow on a dry hill in Trollenäs parish at a distance of 500 m further to the northwest. The fifth locality of presumably naturally established betony is Kungsmarken in Södra Sandby just east of Lund, where a single individual was believed to constitute the entire Swedish population in the 1960s and 1970s. Consequently, a rescue project, described by Mattiasson (2010) and Thell (2016a, 2016b), was initiated in 1981. Only three seeds managed to germinate, but together with vegetatively propagated material from the single remaining specimen, cross pollination was successful. Sixty-three new plants (42 from seeds and 21 vegetatively reproduced plants) were set out in 1988 and Kungsmarken is currently the richest of the naturally occurring localities in Skåne with perhaps as many as 150 specimens. In the past, betony also used to grow in some neighboring parishes. Many localities were carefully listed by Lilja (1838, p. 253, 1870, p. 403), most of which, however, are extinct today. Some additional localities collected or reported rather recently may have been natural, one in Axelvold in Svalöv parish in western Skåne, where it was collected in 1994, and a second one in Mölle, Brunnby parish, where it grew on a meadow north of the railway station until recently, and on a vacant lot, now a private garden where it still grows (Thell, 2016b). Its occurrence in the north of Höör, between Stehag and the ancient Maglö locality, was first believed to be spontaneous (Tyler, 2015), but was later revealed to be planted. In Säby close to Landskrona, there is an introduced population, probably originating from central Skåne.

The first betony report from present-day Denmark appears in the study of Paulli (1648, III, p. 178), who states that “it grows wild in some places in the forests but since there are not very many of them, it is often introduced and planted in gardens.” The report is illustrated with a beautiful woodcut (Fig. 1). Kylling (1688) cites two places for betony, the now extinct occurrence in Rygaard (in Hellerup north of Copenhagen) and Lolland, where it managed to survive to this day. According to Müller in Flora Danica (1778, Vol. 13, Fig. 726), it was still common in the southwestern part of Lolland in the 18th century and was reported to occur in “large amounts” along two parallel roads in Bjerremark (Andersen, 1942, p. 154). In 1999, the number of individuals was reduced to 11 (Helkjær, personal communication), and in 2016, only two flowering plants with two inflorescences each were observed (Fig. 2); in 2017, eight plants developed because the roadside vegetation was not cut so harshly and early as usual. The remaining plants were protected in an agreement with Lolland municipality. The second Danish locality , about 10 km to the northwest, in Tillitse parish in Lolland, is a forest population with too low sun irradiance; therefore, the seven remaining plants were rarely flower. Some, possibly naturally occurring populations, scattered in other parts of Denmark, are all extinct (Hornemann, 1821; Pedersen, 1969; Thell, 2016b).

Fig. 1.
Fig. 1.

Woodcut of betony in Simon Paulli’s Flora Danica Det er: Dansk Urtebog (1648)

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Fig. 2.
Fig. 2.

The roadside locality in Bjerremark on Lolland, where it was collected already in 1853, was the only locality with flowering plants in Denmark in 2016. Two plants with four inflorescenses (arrow) were found. Roadsides are often the last retreat localities for meadow flowers in a modern landscape. One hundred individuals of local origin were planted there 2017–2018 (photo: A. Thell)

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Betony was considered a universal drug, particularly in medieval times, believed to cure a multitude of disorders and diseases in the fields of pain, fever, bad nerves, lung diseases, and in plague remedies (Allen & Hatfield, 2004; pp. 212, 213; Culpeper, 1790, pp. 31, 32; Pedersen, 1534, p. 21). Therefore, it was frequently introduced and cultivated (Ortus [Hortus] Sanitatis, 1517; Paulli, 1648, p. 178, plate 28), and it sometimes escaped from herb gardens. A long-debated question, hitherto not finally answered is whether betony in the flora of Skåne is spontaneous or artificially introduced by human. An attempt to answer this question was made by the Swedish botanist and geneticist Göte Turesson, who performed a comparative garden study of eight betony provenances (Turesson, 1930). He used material from two possibly naturally occurring localities in Skåne, Stehag, and Kungsmarken; two populations from Skåne believed to have a foreign origin, Malmö and Öved; and four samples, from Munich, Vienna, Zagreb, and Moscow, representing the European continent (Turesson, 1930). Plants from Stehag and Kungsmarken flowered earlier and grew to a lower height than the other six provenances in the study. Turesson (1930) concluded that the spontaneous provenances had evolved in genetic isolation. Although the Scandinavian distribution is considered limited to Skåne and Denmark (Figs 3 and 4), an odd locality in Sollentuna near Stockholm exists, composed of several hundred individuals, marked as feral or ruderal by Hultén (1971), could also be spontaneous (Almgren, 1909; Almquist, 1909). It is geographically closer to Estonian localities than those in southern Sweden. Material from this locality is not investigated in this study.

Fig. 3.
Fig. 3.

Distribution of betony in Scandinavia, i.e., Skåne and Lolland, and the adjacent part of Schleswig-Holstein in Germany. Dots represent still existing localities. Note that the northernmost occurrence, in central Skåne, represents four nearby localities (see Fig. 4). Squares show possibly spontaneous but extinct localities. The map is based on Pedersen (1969), Thell (2016b), Simon Kellner, AG Geobotanik in Schleswig-Holstein, and Ulf Schiefelbein, Landesamt für Umwelt, Naturschutz und Geologie, Mecklenburg-Vorpommern

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Fig. 4.
Fig. 4.

The Swedish distribution in detail, concentrated to western central Skåne, southernmost Sweden, where five presumably spontaneous localities remain. The unique “Skåne-duplication” was found in plastid sequences from the three nearby localities 33–35

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Betony occurs on nutrient-rich, calcareous clay soils in rather dry, grass-rich meadows with bushes, often hazel and sloe, and open woods, particularly under oaks (Fig. 5). It is characteristically found in open habitats with the presence of high light and soil water fluctuations. The common meadow phenotype is spread in Europe (Fig. 6), whereas dwarfy phenotypes occur in mountainous areas and in dry habitats where betony plants may be considerably smaller with relatively short and broad inflorescences. As observed in Yorkshire, England, where betony occurs in rather poor and dry meadows, even heathlands, it becomes “dwarfy” in appearance (Stace, 2019, p. 657; Fig. 7). Subspecies and varieties are not generally accepted within B. officinalis; yet, one of our samples, sent from the Botanical Garden in Nancy, was labeled “Betonica officinalis var. montana,” originally from the French Alps. These “dwarf-forms” were included in the study.

Fig. 5.
Fig. 5.

A presumably spontaneous stand of betony in Stehag, July 6, 2017 (photo: N. Thell)

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Fig. 6.
Fig. 6.

Betony cultivated in Stehag July 6, 2017 with buff-tailed bumble bee, Bombus terrestris (photo: N. Thell)

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Fig. 7.
Fig. 7.

Fruiting “dwarfy” phenotype of betony to the left, growing among, for example, common heather, Calluna vulgaris (L.) Hull, on dry, nutrient-poor soil. United Kingdom, Yorkshire, Maltby, August 24, 2017 (38UK) (photo: A. Thell)

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

The Scandinavian betony populations occur in the northwesternmost outposts of its distribution range in Europe, western Asia, and northwestern Africa. Pedersen (1969) describes betony’s world distribution as central European–western Siberian. It occurs in most of Europe, but is rare in Ireland and Scotland, and avoids the Atlantic coast and the steppe zone; in the northeast, it occurs in Estonia and via the lakes Ladoga and Onega to western Siberia and Caucasus, and in the south to Bulgaria, Greece, Italy, and northern Spain; it has also been found in Algeria. Betony was formerly very common throughout Germany (Geiger, 1839, p. 511). It is now almost absent in the northwest and listed in the IUCN Red List for Schleswig-Holstein (Rote Liste gefährdeten Arten; Mierwald & Romahn, 2006). It gradually becomes commoner toward the mountainous regions in the southeast (FloraWeb, 2018; Haeupler & Schönfelder, 1989; Wollert, 2005; Zacharias et al., 1988, p. 59; Zimmermann, 2014).

The seven current, possible natural populations from Scandinavia were included in this study, together with samples from extinct localities in Svalöv and Brunnby parishes, feral material from Säby, and cultivated material from Lund Botanical Garden and Odarslöv, where the latter are remnants of Turesson’s material.

The aim of this study is to test whether betony is spontaneous in Scandinavia by reconstructing its phylogeography by means of DNA analyses in a set of 41 betony samples from 11 European countries (Table 1), with emphasis on the remaining 7 putatively naturally occurring Scandinavian populations.

Table 1.

Material used in the study

SampleTaxonCountry, provinceDistrict, localityYearCollectorHerbarium Acc. noGenBank accession numbers
ETStrnT–trnLtRNA-LeutrnS–trnG
1ATB. officinalisAustria, NiederösterreichKremsland, Willendorf NV2013RühlingOHN222039MG742548MG742579MG742619MG742655
2ATB. officinalisAustria, NiederösterreichKremsland, Willendorf, Wetterkreutz2014RühlingOHN238339MG742549MG742580MG742620MG742656
3BYB. officinalisBelarus, HomyelskayaGomel, Chenki forest2015TsurykauLD1769199MG742550MG742581MG742621MG742657
4BYB. officinalisBelarus. HomyelskayaGomel, Chenki forest [the same spot as number 3]2017TsurykauSee 32MG742582MG742658
5DKB. officinalisDenmark, LollandTillitse, Rudbjerggård1884 [2016]MortensenLD1771056MG742551MG742583MG742623
6DKB. officinalisDenmark. LollandTågerup, Bjerremark1853 [2017]MortensenLD1757551MG742552MG742584MG742622MG742659
7FRB. officinalisFrance, Pays-de-la-LoireLoire-Atlantique, Nantes2017Seed exchange in cultLD1946483MG742585
8FRB. officinalis(var. montana)France. Grand-EstMeurthe-et-Moselle, Nancy2017Seed exchageExtract onlyMG742553MG742586MG742624
9DEB. officinalisGermany. Nordrhein-WestfalenBielefeld, Mühlenmarsch2015BreckleLD1769455MG742554MG742587MG742625MG742660
10DEB. officinalisGermany. SachsenGörlitz, Schönau-Berzdorf2015Ritz and WescheLD1769327MG742555MG742588MG742626MG742661
11DEB. officinalisGermany. SachsenGörlitz, Schönau-Berzdorf2015Ritz and WescheLD1769391MG742556MG742589MG742627MG742662
12DEB. officinalisGermany. Schleswig-HolsteinOstholstein, Dazendorf2016Thell and HedrénLD1895978MG742557MG742590MG742628MG742663
13DEB. officinalisGermany, Schleswig-HolsteinOstholstein, Seegalendorf2016Thell and HedrénLD1899079MG742558MG742591MG742629MG742664
14HUB. officinalisHungary, PestPilis-Visegrád Mts, Pomáz, “Pankos-tető” at Kiskovácsi2017Farkas and LőkösLD1909812MG742559MG742592MG742630MG742665
15HUB. officinalisHungary, PestPilis-Visegrád Mts, Pilisszentlászló, at meadow “Sikárosirét”2017Farkas and LőkösLD1909876MG742593MG742666
16ITB. officinalisItaly, Trentino-Alto AdigeTrento, Carbonare2004S. and B. SnogerupLD1892493MG742560MG742594MG742631MG742667
17LTB. officinalisLithuania, VilniusEnvirons of Trinapolis church and monastery2017MotiejūnaitėLD1930737MG742561MG742595MG742668
18PLB. officinalisPoland, DolnoslaskieWzgórza dalkowskie. Szczyglice apud Glog´w2004Charytonowicz and KoziolLD1891007MG742562MG742596MG742632MG742669
19PLB. officinalisPoland, PomorskieKwidzyn [Marienwerder] Rezerwaty przyrody Kwidzyńskie Ostnice2017Thell, Wszałek-Rożek, Jarosińska, and SeawardLD1909748MG742563MG742597MG742670
20SEB. officinalisSweden, SkåneBrunnby, 150 m NO of Mölle former railway station [extinct]2001LindrothLD1146758MG742564MG742598MG742633
21SEB. officinalisSweden, SkåneBrunnby, Mölle, Möllevångsvägen 152000 [2015]LindrothLD1769263MG742565MG742599MG742634MG742671
22SEB. officinalisSweden, SkåneHöör, Holma meadows [planted]2015TylerLD1801983MG742600MG742635MG742672
23SEB. officinalisSweden. SkåneLund, Botanical Garden [old Swedish grown material]2015Thell and VesteLD1769135MG742566MG742601MG742636MG742673
24SEB. officinalisSweden, SkåneOdarslöv, private garden (remains of the Turesson, 1930 material)2015R. SvenssonLD1770607MG742567MG742602MG742637
25SEB. officinalisSweden, SkåneStehag, Värlinge1860 [2015]SandbergLD1157437MG742603MG742638MG742674
26SEB. officinalisSweden, SkåneStehag, Värlinge2017HedrénExtract onlyMG742568MG742604MG742639MG742675
27SEB. officinalisSweden, SkåneStehag, Värlinge2017HedrénExtract onlyMG742569MG742605MG742640MG742676
28SEB. officinalisSweden, SkåneStehag, Värlinge2017HedrénExtract onlyMG742570MG742606MG742641MG742677
29SEB. officinalisSweden, SkåneStehag, Värlinge2017HedrénExtract onlyMG742571MG742607MG742642MG742678
30SEB. officinalisSweden, SkåneSvalöv, Axelvold [extinct]1994JohanssonLD1151351MG742643
31SEB. officinalisSweden, SkåneSäby, Säbyholm, in grassland close to road [escaped]2007Å. SvenssonLD1292510MG742572MG742608MG742644MG742679
32SEB. officinalisSweden, SkåneSödra Sandby, Kungsmarken1906 [2015]PåhlmanLD1151831MG742573MG742609MG742645MG742680
33SEB. officinalisSweden, SkåneTrollenäs. Ulfstorp meadow1924 (2015]LangeLD1152775MG742574MG742610MG742646MG742681
34SEB. officinalisSweden, SkåneVästra Sallerup, Kastberga skog1947 [2015]LangeLD1157377MG742611MG742647MG742682
35SEB. officinalisSweden, SkåneVästra Sallerup, Kastberga meadow1940 [2015]NilssonLD1551531MG742575MG742612MG742648MG742683
36UKB. officinalisUnited Kingdom, EnglandWest Yorkshire, Wakefield, Moor Lane2017Persson, Seaward, and ThellLD1908068MG742613MG742649
37UKB. officinalisUnited Kingdom, EnglandWest Yorkshire, Wakefield, E part of Brockadale Nature Reserve [dwarfy phenotype]2017Persson, Seaward and ThellLD1908004MG742614MG742650
38UKB. officinalisUnited Kingdom, EnglandNorth Yorkshire, Maltby [dwarfy phenotype]2017Persson, Seaward, and ThellLD1933169MG742615MG742651
39ITB. hirsutaItaly, Trentino-Alto AdigeTrento, Tonale2016HedrénLD1933876MG742577MG742617MG742653MG742684
40ITB. hirsutaItaly, Trentino-Alto AdigeTrento, Tonale2016HedrénLD1899015MG742578MG742618MG742654MG742685
41ITStachys alopecurosItaly, LazioRieti, Passo Terminillo2016HedrénLD1934004MG742576MG742616MG742652

Note. All specimens belong to Betonica officinalis L. except for numbers 39–41 which belong to the outgroups, B. hirsuta L., 39–40, and Stachys alopecuros (L.) Benth. Year within square bracket indicates fresh collections at the old locality.

Materials and Methods

Materials

Thirty-eight samples of B. officinalis were included in this study. As outgroups or reference materials, two specimens of Betonica hirsuta L. and one specimen of Stachys alopecuros (L.) Benth. were selected (Figs 8 and 9). The samples were collected in 11 European countries (Table 1; Fig. 10). Most specimens used are stored in the botanical collections of the Biological Museum, Lund University (LD). Two samples were on loan from the herbarium in Oskarshamn (OHN), and two samples reached us through seed exchange with the Botanical Gardens of Nancy and Nantes in France. Four samples from Stehag in Skåne are preserved as DNA extracts only. Most specimens were collected by us and some were sent by colleagues. In Scandinavia, where betony is a rare and protected species, only fragments were collected for the DNA analyses. In such cases, we refer to old herbarium sheets from the same localities as vouchers (Table 1). All material, both old and new herbarium sheets, is registered in the public database Sweden’s Virtual Herbarium (herbarium.emg.umu.se). All non-Swedish samples are assumed to be naturally established in their localities. For the province Skåne, on which the study is focused, the samples are either from the five presumably naturally occurring localities or from planted or escaped populations to confirm a presumed origin or, in one case, of completely unknown origin (Table 1).

Fig. 8.
Fig. 8.

Betonica hirsuta L., Trento, Italy, July 8, 2016 (39–40IT) (photo: M. Hedrén)

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Fig. 9.
Fig. 9.

Stachys alopecuros (L.) Benth. Lazio, Italy, July 8, 2016 (41IT) (photo: M. Hedrén)

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Fig. 10.
Fig. 10.

Sites of the studied samples. Forty-one samples from 11 European countries were included in the study

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

DNA extraction

Total DNA used for PCR amplification and sequencing was mainly extracted with the DNeasy plant mini kit (Qiagen, Germany). A few DNA extracts were obtained by the REDExtract-N-Amp Plant PCR kit (Sigma, USA) but the produced DNA extracts were less suitable for PCR. Extractions were made from fresh or dried leaf material for all samples except sample 8 (Table 1), for which seeds were used.

Amplification and sequencing

Four gene regions were successfully amplified and sequenced (Tables 25), three plastid regions: the trnT–trnL intergenic spacer (IGS) region, the tRNA-Leu (trnL) intron, and the trnS–trnG IGS; partial sequence (Prince & Kress, 2006; Shaw et al., 2005); and one nuclear region, the external transcribed spacer (ETS) of the rDNA repeat region (Baldwin & Markos, 1998). However, additional regions were tested without success (Table 2). PCR reactions were performed with a Mastercycler pro (Eppendorf, Germany) using the following programs: ETS: 94 °C for 5 min (94 °C for 1 min, 58 °C 30 s, 72 °C for 1 min) × 30 cycles, 72 °C for 5 min; trnT–trnL spacer and trnL intron: 94 °C for 3 min (94 °C for 1 min, 52 °C for 1 min, 72 °C for 2 min) × 35 cycles, 72 °C for 5 min; trnS–trnG spacer: 94°C for 4 min (94 °C for 30 s, 55 °C for 1 min, 72 °C for 1 min) × 26 cycles, 72 °C for 10 min. PCR products were visualized by agarose gel electrophoresis and those of good quality were directly purified with Illustra ExoProStar 1-Step (GE Healthcare, UK) and sent to Eurofins Genomics (Germany) for Sanger sequencing. In the case of an unspecific product, the desired band was excised from the gel for extraction and purification with a Nucleospin PCR clean-up and Gel extraction kit from Macherey-Nagel (Germany) before being sent to sequencing as above.

Table 2.

Primers tried and used in the phylogenetic analyses

DNA-regionPrimers and referencesPrimer sequences
ETS – intergenic spacer between the 18S and 26S rRNA genes, nuclear gene trnT–trnL, intergenic spacer region; plastid gene18S-ETS (Baldwin & Markos, 1998, p. 450) and 5′ ETS-B (Beardsley & Olmsted, 2002: 1094)18S-ETS: 3′-ACTTACACATGCATGGCTTAATCT-5
ETS-B: 3-ATAGAGCGCGTGAGTGGTG-3
trnT–trnL – intergenic spacer region; plastid genePrimers a and b

Taberlet et al. (1991, p. 1106)
a: 5-CATTACAAATGCGATGCTCT-3
b: 5TCTACCGATTTCGCCATATC-3
trnL, intron; plastid genec and d in Taberlet et al. (1991, p. 1106)c: 5-CGAAATCGGTAGACGCTACG-3
d: 5GGGGATAGAGGGACTTGAAC-3
trnL–trnF – intergenic spacer region; plastid genee and f in Taberlet et al. (1991, p. 1106)e: 5′-GGTTCAAGTCCCTCTATCCC-3′
f: 5′-ATTTGAACTGGTGACACGAG-3′
trnS–trnG – intergenic spacer, partial sequence; plastid genetrnS (GCU) and trnG (UCC) (Hamilton, 1999, p. 522)5-GCCGCTTTAGTCCACTCAGC-3
5-GAACGAATCACACTTTTACCAC-3
5.8S rRNA gene and its flanking spacer regions (ITS); nuclear geneITS4 and ITS5 (White et al., 1991)ITS4: 5′-TCCTCCGCTTATTGATATGC-3′
ITS5: 5′-GGAAGTAAAAGTCGTAACAAGG-3′
5.8S rRNA gene and its flanking spacer regions (ITS); nuclear geneITS1 and ITS4 (White et al., 1991)ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′
ITS4: 5′-TCCTCCGCTTATTGATATGC-3′
5.8S rRNA gene and its flanking spacer regions (ITS1 and ITS2); nuclear geneITS4 (White et al., 1991) and leu1 (Urbatsch et al., 2000) as “ITS1”, later ITSleu1 (Bohs & Olmstead, 2001)ITS4: 5′-TCCTCCGCTTATTGATATGC-3′
ITSleu1: 5′-GTCCACTGAACCTTATCATTTAG-3′
5.8S rRNA gene and its flanking spacer regions (ITS1 and ITS2); nuclear geneITS5a and ITS241R (Prince & Kress, 2006)ITS5a: 5′-TTATCATTTAGAGGAAGGAGAAGTC-3′
ITS241R: 5′-CAGTGCCTCGTGGTGCGACA-3′
5.8S rRNA gene and its flanking spacer regions (ITS and ITS2); nuclear geneITS5a_alt (Stanford et al., 2000) and ITS241R (Prince & Kress, 2006)ITS5a_alt: 5′-CCTTATCATTTAGAGGAAGGAG-3′
ITS241R: 5′-CAGTGCCTCGTGGTGCGACA-3′
tRNA-His (GUG) to exon 1 of tRNA-Lys (UUU); plastid genetrnHt and trnK1A (Demesure et al., 1995)trnHt: 5′-ACGGGAATTGAACCCGCGCA-3′
trnK1A: 5′-CCGACTAGTTCCGGGTTCGA-3′
tRNA-Ser (UGA) to tRNA-fMet (CAU); plastid genetrnS2 and trnfM (Demesure et al., 1995)trnS2: 5′-GAGAGAGAGGGATTCGAACC-3′
trnfM: 5′-CATAACCTTGAGGTCACGGG-3′
tRNA-Ser (GGA) to tRNA-Thr (UGU); plastid genetrnS4 and trnT3 (Demesure et al., 1995)trnS4: 5′-CGAGGGTTCGAATCCCTCTC-3′
trnT3: 5′-AGAGCATCGCATTTGTAATG-3′

Note. Those successfully employed are given in boldface.

Phylogenetic methods

Nuclear and plastid sequences were analyzed both separately and merged. All sequences used in this study are obtained de novo (Table 1). No sequences of interest for completion were found in the GenBank. Sequences were processed in MEGA7 (Temple University, Philadelphia, USA; King Abdulaziz University, Jeddah, Saudi Arabia; and Tokyo Metropolitan University, Hachioji, Japan), aligned by Muscle and adjusted by visual inspection (Hall, 2013; Kumar et al., 2016). Phylogenetic trees were reconstructed in MEGA7 using two statistical methods, maximum parsimony (MP) using the search method Tree Bisection Reconnection and maximum likelihood (ML) using the General Time Reversible Model. All sites, including gaps and missing characters were used. All gaps were recoded to letters and treated as a fifth character, except for a deletion in one of the outgroups, B. hirsuta, where only one site was recoded to letters. The “Skåne-duplication” was replaced as one character only. Finally, a bootstrap test was performed for both statistical methods with 1,000 replicates (Felsenstein, 1985). Separate analyses were performed for plastid sequences, ETS sequences, and a combined matrix of ETS and plastid sequences.

Phenetic analysis of the ETS sequence variation

Data for phenetic analysis of the ETS region were obtained by Sanger sequencing of genomic DNA. ETS is part of the nuclear rDNA repeat regions. rDNA genes are located in tandemly repeated units consisting of the three rDNA genes 18S, 5.8S, and 25S separated by the internal transcribed spacer regions ITS 1 and ITS 2, respectively (Jorgensen & Cluster, 1988). The repeat units are separated by the ETS and the non-transcribed IGS. rDNA repeat units typically occur between 1,000 and 10,000 copies in any haploid genome, and may be distributed between one and several loci. Because of the large number of gene copies, only relative proportions of sequence variants could be estimated by inspection of the peak sizes in the electropherograms obtained from the sequencer. In addition, because sequence variants may occur within and between loci, the origin of different sequence variants could not be traced to any specific locus. Moreover, when more than one variable site was identified in a sequence, we had no information on how the variants at different positions along the ETS sequence were related to each other. To extract as much information as possible without adding bias, we therefore had to interpret each variable position as an independent character and perform a phenetic analysis of our combined data set (see Pillon et al., 2007 for an example of this methodology). Relative peak sizes recorded from the variable positions in ETS (Table 5; Fig. 11) were translated into allele frequency data and used in calculating pairwise Cavalli-Sforza Chord distances between accessions (Cavalli-Sforza & Edwards, 1967), as if allele frequencies were representing population averages. Due to the fact that allele frequencies were estimated from sequence data, linkage between positions could not be estimated and positions were essentially treated as unlinked loci. The matrix of pairwise genetic distances was rotated in a principal coordinates analysis (PCOA) to extract the maximum proportion of dispersion between samples along the first two principal coordinates. Cavalli-Sforza chord distances and the PCOA were calculated using NTSYSpc (Exeter Software, Setauket, NY, USA; Rohlf, 2005).

Fig. 11.
Fig. 11.

Part of ETS sequence (sample 19PL, Table 1) showing four variable loci, 169, 245, 254, and 290, and their relative peak sizes (Table 6)

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Results

Identification of genetic variation

One hundred and thirty-eight sequences were produced for the phylogenetic analyses and submitted to GenBank. The entire matrix, after alignment, measured 2,375 bp, including the outgroups B. hirsuta and S. alopecuros; 147 variations in the DNA (mostly SNPs) were found, of which 39 concerned the ingroup only (Table 3). The total matrix was composed of four molecular regions. The ETS matrix had a length of 435 bp. One deletion and 50 SNPs were found, of which 10 were of interest for the ingroup (Tables 35). The trnT–trnL IGS region in the chloroplast had a length of 712 bp, revealing 43 sequence variants of which 24 provided information of the ingroup. This variation also included a 19-bp-long duplication in some of the Swedish samples (the “Skåne-duplication”). Concerning the 499-bp intron region of the chloroplastic trnL gene, the alignment resulted in 11 SNPs of which only two were relevant for the ingroup. Finally, the partial trnS–trnG IGS in the chloroplast was 729-bp long, including 43 informative DNA variants. Because the major part of the variation depended on a 33-bp long deletion in B. hirsuta, only three SNPs provided information to the ingroup (Tables 3 and 4).

Table 3.

Number of sequences, total number characters, and parsimony informative characters used in the phylogenetic analyses

DNA regionNumber of sequencesNumber of charactersParsimony informative charactersParsimony informative characters restricted to the ingroup
ETS314355110
trnT–trnL intergenic spacer region, chloroplast407124324
tRNA-Leu (trnL) gene, intron, chloroplast36499112
trnS–trnG intergenic spacer, partial sequence, chloroplast31729433
Total138237514739
Table 4.

Informative plastid characters within Betonica officinalis

RegiontrnT–trnLtRNA-LeutrnS–trnG
Site116140183< >184237250425147183184329529
1ATGT–––––––––––––––––––TTTTATTT
2ATGT–––––––––––––––––––TTTTATTT
3BYGT–––––––––––––––––––TTTTATTG
4BYGT–––––––––––––––––––TTNNNTTG
5DKGT–––––––––––––––––––TTTTANNN
6DKGT–––––––––––––––––––TTTTATTT
7FRGT–––––––––––––––––––TTTNNNNN
8FRGT–––––––––––––––––––TTTCNNN
9DEGT–––––––––––––––––––TTTAGTN
10DEGT–––––––––––––––––––TTTTATTT
11DEGT–––––––––––––––––––TTTAGTT
12DEGT–––––––––––––––––––TTTTATTT
13DEGT–––––––––––––––––––TTTTATTG
14HUGT–––––––––––––––––––TTTTATTT
15HUGT–––––––––––––––––––TTTNNTTT
16ITAT–––––––––––––––––––TTAGTT
17LTGT–––––––––––––––––––TTTNNTTG
18PLGT–––––––––––––––––––TTTTATTT
19PLGT–––––––––––––––––––TTTNNTTG
20SEGT–––––––––––––––––––TTTANNN
21SEGT–––––––––––––––––––TTTAGT
22SEGT–––––––––––––––––––TTCAGTT
23SEGG–––––––––––––––––––TTTTATTT
24SEGTTCGAATATTATTCTATTCCTTTTANNN
25SEGT–––––––––––––––––––TTTTATTG
26SEGT–––––––––––––––––––TTTTATTG
27SEGT–––––––––––––––––––TTTTATTG
28SEGT–––––––––––––––––––TTTTATTG
29SEGT–––––––––––––––––––TTTTATTG
30SENNNNNNNNNNNNNNNNNNNNNNNNTANNN
31SEGTTCGAATATTATTCTATTCCTTTTATTG
32SEGT–––––––––––––––––––TTTTATTG
33SEGTTCGAATATTATTCTATTCCTTTTATTG
34SEGTTCGAATATTATTCTATTCCTTTTATTG
35SEGTTCGAATATTATTCTATTCCTTTTATTG
36UKGT–––––––––––––––––––TTCANNN
37UKGT–––––––––––––––––––TGTANNN
38UKGT–––––––––––––––––––TGTANNN

Note. The “Skåne-duplication” is positioned between characters 183 and 184 in the trnT–trnL sequence. N: missing character.

Phylogeography

Several branches with bootstrap support of more than 50% were revealed in the separate phylogenetic trees based on plastid and ETS sequences as well as in the combined tree based on the merged matrix (Figs 1217). However, groups supported in phylogenetic analyses based on ETS sequences were not supported in the plastid phylogeny, and groups supported in phylogenetic analyses based on plastid sequences were not supported in the ETS phylogeny because of lacking ETS sequences (Table 5). In addition, using different phylogeny methods, such as MP or ML, resulted in similar results but the ML method generally gave stronger support. Seven groups, such as I–VII, were supported by different matrices and methods (Table 5; Figs 1217).

Fig. 12.
Fig. 12.

Bootstrap consensus tree based on plastid sequences using the maximum parsimony (MP) method and the Tree-Bisection-Reconnection (TBR) model. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicates in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown above thick branches. Supported groups I–III, are indicated beneath thick branches

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

The phylogeny based on plastid sequences using MP resulted in five most parsimonious trees, tree length = 98, consistency index (CI) = 0.973333, retention index (RI) =0.987013. Three groups with support were identified. A group of five samples wearing the “Skåne-duplication” (I) had maximum support in the bootstrap analysis (Table 5; Fig. 12). The strongest bootstrap support, 76%, was found for a group of two dwarfy samples, 37–38UK (II), collected at dry places, dry meadow and heath in Yorkshire respectively (Table 5; Fig. 12). The second strongest supported branch, bootstrap support 69%, was composed of a sample from Moor Lane, 36UK, growing in a rather wet meadow in Yorkshire and one sample representing material introduced into Sweden, i.e., a population known to be planted in a meadow north of Höör, 22SE (III), in central Skåne (Table 5; Fig. 12). However, the method supported the same three groups with maximum support for taxa having the Skåne-duplication (Fig. 13). The ML method calculated a tree with the highest log likelihood: −3159.4764.

Table 5.

Groups with bootstrap support in phylogenetic analyses using different matrices and methods

GroupSamplesPlastid sequences MP (Fig. 12)Plastid sequences ML (Fig. 13)ETS sequences MP (Fig. 14)ETS sequences ML (Fig. 15)ETS and plastid sequences MP (Fig. 16)ETS and plastid sequences ML (Fig. 17)
IThe “Skåne-duplication”911009292
IIThe “dwarfy phenotype”76657660
III22SE + 36UK6954800
IV1AT, 3BY, 17LT, 19PL, 20–21SE, 29SE, 35SE00666300
V11DE + 16IT00<505468<50
VI20–21SE00005363
VII17LT + 19PL000<50055

Note. MP: maximum parsimony; ML: maximum likelihood.

Fig. 13.
Fig. 13.

Bootstrap consensus tree based on plastid sequences using the maximum likelihood (ML) method and the General Time Reversible (GTR) model. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicates in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown above thick branches. Supported groups I–III are indicated beneath thick branches

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

The ETS phylogeny using MP resulted in seven most parsimonious trees (tree length = 29, CI = 0.952381, RI =0.972973). Using the ETS matrix and MP resulted in one group with support: eight samples from Sweden, Belarus, Poland, Lithuania, and Austria (IVd) had a weak bootstrap support value of 66% (Table 5; Fig. 14). This group was not supported in the analysis based on the merged ETS and plastid matrices (Figs 16 and 17). Group IV had a support of 63% in the bootstrap analysis using the ML method. An additional group (V) was weakly supported, 54%, in the bootstrap analysis. One of the German samples, 11DE, formed a branch with the Italian sample, 16IT (Fig. 15). None of the groups supported in the plastid phylogeny were supported in the ETS phylogeny because of lacking data. Amplification of ETS sequences was for English samples and the “Skåne-duplication” is situated in one of the plastid sequences. The ML method resulted in a tree with the highest log likelihood: −762.8425.

Fig. 14.
Fig. 14.

Bootstrap consensus tree based on ETS sequences using the maximum parsimony (MP) method and the Tree-Bisection-Reconnection (TBR). Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicates in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown above thick branches. The percentage of replicates in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown above thick branches. The supported group IV, is indicated beneath the thick branch

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Fig. 15.
Fig. 15.

Bootstrap consensus tree based on ETS sequences using the maximum likelihood (ML) method and the General Time Reversible (GTR) model. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicates in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown above thick branches. Supported groups IV and V, are indicated beneath thick branches

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Fig. 16.
Fig. 16.

Bootstrap consensus tree based on the merged plastid and ETS matrices using the maximum parsimony (MP) method and the Tree-Bisection-Reconnection (TBR). Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicates in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown above thick branches. Supported groups II–VI, are indicated beneath thick branches

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Fig. 17.
Fig. 17.

Bootstrap consensus tree based on the merged plastid and ETS matrices using the Maximum Likelihood (ML) method and the Tree-Bisection-Reconnection (TBR). Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicates in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown above thick branches. Supported groups I, II, VI, and VII, are indicated beneath thick branches

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

A total phylogeny of the merged ETS and plastid matrices using MP resulted in six most parsimonious trees (length =157, CI = 0.940000, RI = 0.968586). This analysis confirmed three of the above five branches with moderate support. The dwarfy English samples, 37–38UK (II), having a support of 76%. The sample from Moor Lane in Yorkshire and the sample from Höör in Skåne (III), having a support of 80%. One of the German samples, 11DE and the Italian 16IT, form a branch, V, with bootstrap support 68%. Finally, with a weak bootstrap support of 53%, the two samples from Brunnby in Skåne, 20–21SE (VI), formed a branch in the total analysis (Table 5; Fig. 16). The samples wearing the “Skåne-duplication” was strongly supported in the bootstrap analysis, 92%. Using ML, the “Skåne-duplication” received the same strong support. In addition, the ML gives support, although weak (55%), to a group including the samples from northern Poland, 19PL, and Lithuania, 17LT (VII). The group composed of the German sample 11DE and the Italian 16IT has no support using ML (Table 5; Fig. 17). A tree with the highest log likelihood, −4238.5636, was calculated.

The variation detected at the 28 variable positions in the ETS sequences, including the 10 parsimony informative characters, provided a clearer picture of the geographic variation patterns than the phylogeny based on plastid sequences (Table 6). Representative samples from all seven putatively spontaneous localities in Skåne and Denmark, with or without the “Skåne-duplication,” clustered close together (Fig. 18). Furthermore, some cultivated or feral populations from Skåne, with origins we intended to verify, were positioned in the same group indicating local origins. Since six samples lack data from the variable ETS positions, their positions in the PCOA ordination were determined only or mainly by the 10 parsimony informative ETS characters and therefore have uncertain positions (Table 6; Fig. 18).

Table 6.

The 28 variable ETS sites within Betonica officinalis, 10 of which are parsimony informative

Char.343439397373112112121121138138142142142143143155155162162169169170170171171180180180197197201201207207228228232232245245245245246246254254262262264264276276290290296296396396
GAGAATGACAGAATGGACAGATCGATCGATCAAGGACTTACAGTCTAGGTAGTAGTCGGA
1AT101010101010.51.490101010.49.511010100101010101010001010.62.381010101010
2AT101010101010100101010101010100101010101010001010101010101010
3BY101010101010100.57.431010011010100101010101010001010.79.21.77.2310101010
5DK101010101010100101010.75.251010100101010101010001010.78.221010101010
6DK101010101010100101010101010100101010101010001010101010101010
8FR101010101010100101010101010100101010101010001010101010101010
9DE101010101010100101010101010100101010101010001010101010101010
10DE1010101010101001010.53.47101010100101010101010001010101010101010
11DE.81.19.68.32101010.52.481001010.44.56101010.45.5501010101010.520.480.71.29.65.351010.37.631010.63.37
12DE.57.43.42.58.81.191010101001010.88.12.88.1210.89.11.920.081010.89.111010.26.7400.42.58.37.6310101010.87.13.33.67
13DE101010101010.52.26.221010.72.28.84.16101010010101010101000.62.38.86.141010101010.58.42
14HU101010101010.67.330101010.76.261010100101010101010001010.41.59.75.2510101010
16IT10.64.36101010.86.14.840.1610.86.14.68.32.78.2210101001010101010.45.5500.62.38.60.40.89.1110101010.61.39
17LT101010101010100.83.171010.23.7710101001010101010100010.74.26.76.24.60.4010101010
18PL10.83.171010.78.22101001010.81.19.62.3810101001010101010.7900.21.85.15.65.35.73.27.79.21101010.80.20
19PL1010101010.90.10100.85.151010.25.751010100.85.1510101010.8100.1910.67.3310.75.2510.82.181010
20SE101010101010.86.1401010.80.20.48.521010100101010101010001010101010101010
21SE101010101010100.59.411010.25.751010100101010101010101010101010101010
23SE101010.86.1410.80.20.83.1701010.76.24.69.31.90.101010010101010.75.2510001010.64.361010101010
24SE101010101010.60.4001010.76.24.58.42101010010.79.2110.83.171010001010.73.271010101010
26SE1010101010.90.10.77.3301010.88.12.61.39101010010.76.2410.80.201010001010.83.171010101010
27SE1010101010101001010.88.12.61.39101010010.83.1710101010001010101010101010
28SE10.85.1510101010.82.1801010.80.20.52.48101010010.79.2110101010001010101010101010
29SE10.74.2610101010.92.080101010.31.69101010010.91.0910101010001010101010101010
31SE101010101010.92.080101010.68.32101010010101010.81.1910001010.86.141010101010
32SE101010.89.1110.91.09.82.1801010.88.12.68.32.88.121010010.86.141010.85.1510001010.84.16.92.0810101010
33SE101010101010.82.1801010.85.15.64.36101010010101010.88.1210001010.80.201010101010
35SE101010101010.62.3801010.72.28.48.521010100101010101010001010.58.421010101010

Note. Sequences 2, 6, 8, 9, and 10 were not sharp enough for measuring variation, for which only the 10 parsimony informative characters were included in the PCOA, marked in plane pace in Fig. 18. The outgroups, 39–41, were excluded from the PCOA ordination, since they were too deviant from B. officinalis sequences. Sequences with complete variation are in boldface.

Fig. 18.
Fig. 18.

PCOA ordination including representatives from all seven putatively spontaneous localities from Scandinavia, with or without the “Skåne-duplication,” clustered close together and is marked as filled dots. Six samples, 2, 6, 8–10, and 21, lack data from the variable loci, partly or entirely. Their positions were therefore uncertain and determined mainly by the ten parsimony informative ETS characters (Table 6). Samples with all variation determined are in bold face

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

SNPs and autapomorphies

Unique SNPs in the ETS region were found exclusively in German material. One sample from Schleswig-Holstein had three SNPs, whereas material from Sachsen had two SNPs. However, as many as 28 positions were variable within or between accessions (see below). Of the 31 ETS sequences, 26 were clear enough to estimate relative peak sizes directly from the chromatograms (Table 6; Fig. 11). Variable positions mostly involved two alternative bases, but two positions, 142 and 180, expressed three alternative bases, and all four bases were found at position 245 (Table 6). Individual samples were mostly variable with two alternative bases at any single position, but in sample 13DE from Germany, three different bases were expressed at position 142 (Table 6). The two outgroup species did not show any ETS variability and were excluded from the ETS analysis. Sequences where relative peak heights could not be estimated were coded entirely for the highest peak at each position, except for samples 10DE and 21SE, where variation could be estimated at a fraction of the variable positions, at one and two positions, respectively (Table 6).

Five of the samples from the province of Skåne had a unique 19 bases long duplication situated between positions 183 and 184 in the trnT–trnL sequence (Table 4). The sample from Italy had one autapomorphy and one unique gap. The sample from Lund Botanical Garden, referred to as “old established Swedish grown material” according to the former superintendent Lennart Engstrand, also had one autapomorphy in the trnT–trnL sequence. The collection from the French Alps labeled B. officinalis var. montana ined. [Stachys officinalis var. montana (Lej.) Dumort.] carried the single autapomorphy in the trnL intron sequence (Table 4), whereas no autapomorphies were observed in the trnS–trnG IGS.

Discussion

Several primer pairs were tested in this explorative study, some of which failed (Table 2). A second nuclear rDNA region in addition to ETS, comprising the internal transcribed spacers (ITS), was also tested, but failed for unknown reasons (Table 2), in spite of the fact that ITS has been successfully sequenced in an earlier study of B. officinalis published by Salmaki et al. (2012, 2013). ITS is also provided as an unpublished sequence JF330306 by Akcicek et al. in GenBank (www.ncbi.nlm.nih.gov), and has been sequenced in other members of the Lamiaceae (Silveira & Simpson, 2013) and in other families within the Lamiales (Beardsley & Olmstead, 2002). In the latter study, it was stated that ETS is relatively easy to amplify compared to ITS, but without explaining or discussing possible reasons. Both ETS and ITS have been successfully used in resolving the phylogeny of not-too-distantly related species and genera of vascular plants. The ETS region is longer than ITS (ITS1 + ITS2) and also offers more variation since it evolves faster (Baldwin & Markos, 1998; Beardsley & Olmstead, 2002); hence, it would probably add little useful information to our intraspecific study.

However, the phylogeography indicated a possible spontaneous origin for some of the Scandinavian populations, a pattern most apparent in the PCOA of the ETS data and for samples with complete sequences since they formed one group (Fig. 18). A spontaneous origin was indicated only for populations wearing the “Skåne-duplication” in the phylogenetic tree based on plastid sequences, which formed a branch with moderate support. Since the main focus of the study was on putatively spontaneous populations in Denmark and Skåne, the investigated localities or populations are described and discussed, including their history. In Denmark, there are two populations regarded as spontaneous left, in Tillitse and Tågerup parishes. Stehag, Södra Sandby, Trollenäs, and Västra Sallerup are four parishes in Skåne that still hold betony localities of presumably spontaneous origin. Additional localities from Skåne, included in the analyses, have different background according to the results. Three populations from Skåne with unknown origins are positioned in the “Scandinavian group” in the ETS ordination, those from Brunnby parish, 20–21SE, and Lund Botanical Garden, 23SE. This result was not supported by the phylogenetic analyses. However, a branch composed exclusively of Swedish samples containing the “Skåne-duplication” was supported by the analysis based on plastid sequences, that is, material collected in the three neighboring localities in Trollenäs and Västra Sallerup parishes and, in addition, in cultivated material from Odarslöv, 24SE, and in feral plants from Säby, 31SE. The cultivated material obtained from Odarslöv and Säby is believed to have an origin in central Skåne, whereas the population in the north of Höör has an origin in England, according to our results based on plastid sequences, 22SE and 36UK. We did not succeed to sequence ETS from these two samples.

Possibly spontaneous localities in Scandinavia

Denmark, Lolland: Tågerup and Tillitse parishes

The two still existing populations in Denmark, situated near Rudbjerggaard castle in Tillitse parish, 5DK and in Bjerremark in Tågerup parish, 6DK, are last remnants of a rather large distribution area in southwestern Lolland (Andersen, 1942; Müller, 1778). Both two populations were represented and bore a relationship with the Swedish populations according to the PCOA ordination (Fig. 18).

Sweden, Skåne: Stehag parish

The historically interesting locality in Stehag was represented by several individuals in the analyses (25–29SE; Table 1). They were not located close together in the PCOA ordination, but were somewhat separated from each other within the Scandinavian group (Fig. 18).

Sweden, Skåne: Södra Sandby parish

The sample from Kungsmarken in Södra Sandby parish, 32SE, is closely related to the sample 26SE from Stehag, according to the PCOA ordination (Fig. 18).

Sweden, Skåne: Trollenäs and Västra Sallerup

Three localities, 33–35SE, are situated along 1 km, almost straight line from Trollenäs parish in the northwest to Kastberga meadow and forest in Västra Sallerup toward the southeast (Fig. 4). They constituted a core of the possibly spontaneous distribution in Skåne, geographically and genetically, since they received support both in the PCOA ordination and in the plastid phylogeny where they belonged to the branch of populations wearing the “Skåne-duplication” (Figs 12, 13, 16, 17).

Cultures with a possible origin in Scandinavia

Sweden, Skåne: Brunnby parish

One of the now extinct populations in Brunnby parish, had a natural appearance, growing on a meadow just northeast of the railway station in the township Mölle. However, since it was collected there remarkably rarely, only once, in 1904, before the early 2000s, it was perhaps introduced from material taken from central Skåne. The two samples from Brunnby form a weakly supported branch in the total analyses (Figs 16 and 17).

Sweden, Skåne: Lund

The sample collected in the spice garden in Lund Botanical Garden, “old established Swedish grown material” (Lennart Engstrand, pers. comm.), probably originated from Skåne, perhaps from a mixed material, since other populations of betony also grow in the garden, including material originating from Kungsmarken in Skåne.

Sweden, Skåne: Odarslöv parish

Populations from Skåne, including this one from Odars-löv, with or without the “Skåne duplication” formed one group, in the PCOA ordination (Fig. 18). The sample from Odarslöv originates from the same material that Turesson (1930) used in his garden study, but unknown from which of his eight localities. However, it contains the “Skåne-duplication,” thus supported in the “Skåne-duplication” branch in the phylogenetic tree based on plastid sequences. Interestingly, the “Skåne-duplication” has not been found in material from the two other presumably naturally occurring localities in Skåne, i.e., Stehag and Kungsmarken in Södra Sandby, the two populations from Skåne represented in the study by Turesson (1930). Plants with the “Skåne-duplication” may have previously occurred in Stehag, or maybe still do, since the duplication was detected in samples collected only a few kilometers away in Västra Sallerup and Trollenäs parishes, an area formerly connected by coherent meadow forests according to old maps.

Sweden, Skåne: Svalöv parish

The sample from Axelvold in Svalöv parish, 30SE, collected in 1994, has been searched at its original site at multiple occasions, but without success (Thell, 2016b). A fragment from the collection was included in the analysis, but only DNA from the trnL intron was successfully amplified, which was not enough for indicating its origin (Figs 12 and 13). The locality may have been spontaneous since it would fit rather well with the distribution area.

Sweden, Skåne: Säby parish

The population in Säby is believed to have escaped from the well-known botanist Arvid Nilsson’s culture at Säbyholm. This population was probably established from material collected in central Skåne, perhaps in Trollenäs, the richest locality during Nilsson’s most active period (J. T. Johansson, personal communication). This presumption is supported by the presence of the “Skåne-duplication” (Table 4; Figs 12, 13, 16, and 17).

Scandinavian population with foreign origin

Höör parish

A foreign origin was supported only for the population from Höör, 22SE, among samples from Skåne, whose closest relative was found in Yorkshire (Figs 12, 13, 16).

Extrascandinavian populations

France and the United Kingdom – Different genotypes or taxa

Separated from the phylogeographic patterns, two distinct genotypes were distinguished in the plastid sequences, the “dwarfy” populations from France and the United Kingdom, one mountain genotype and one heath genotype, which may deserve taxonomic recognition (Figs 7, 12, 13, 16, 17). The mountain genotype has been described as Stachys officinalis var. montana (Lej.) Dumort., but this variety is rarely separated in modern literature. Meadow populations in France and the United Kingdom appeared to be more closely related to foreign meadow populations than with the local mountain and heath genotypes (Figs 12, 13, 16, 17). Betony is rare in western France and in Britain and Ireland. It is very rare in Ireland, where it occurs only in Cork and is also rare Kerry counties (Parnell & Curtius, 2012), and also rare in Scotland and Wales according to Stace (2019, p. 657) who states that it may be “very dwarfy on grassy cliff tops,” but he does not recognize this form taxonomically. In Yorkshire, where betony was collected for this study, both standard and more or less dwarfy phenotypes were collected. Three samples were selected among the material for the study, where sample 36UK could be referred to as common meadow form, growing in a rather moist meadow, while sample 37UK is dwarfy and collected from a dry meadow on calcareous soil and sample 38UK grew on a moist heath (Table 1; Fig. 7). The two dwarfy samples formed a moderately supported branch in the phylogenetic tree, whereas 36UK differed genetically and formed a branch with the planted material from Höör, Sweden, except when using the merged matrix and the ML method (Figs 12, 13, and 16). We did not manage to sequence ETS from any of the Yorkshire samples. The dwarfy samples usually had comparatively short, rounded spikes, with fewer flowers (Figs 7 and 19), and often without an extra whorl of flowers a piece beneath the main cluster, characteristic for the common meadow form (Fig. 6). The different phenotypes collected in Yorkshire is currently being compared in a garden experiment to observe how they differ from each other and from other European samples when grown under the same conditions, and an early observation shows that the dwarfy phenotype remains dwarfy when grown in rich soil (Fig. 19). According to Stace (2019, p. 657), betony avoids heavy soils in Britain, as opposed to its preferences in Scandinavia.

Fig. 19.
Fig. 19.

The dwarfy phenotype from a heath in Yorkshire (38UK) remains dwarfy when grown in rich soil, here seen in a comparative culture together with common meadow forms from Germany (13DE), Sweden (25-29SE), and Poland (19PL). June 8 and July 9, 2019 (photo: A. Thell)

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

Austria and Hungary

The Austrian samples, 1–2AT, are geographically closest to the Hungarian samples, 14HU and 15HU, and the population from Southern Poland, 18PL (Fig. 10). The two Austrian samples differed slightly from each other at ETS position 142, 169, and 262 (Table 6). The ordination based on ETS data indicated a relationship between 1AT and the Hungarian sample 14HU. The second Austrian sample, 2AT, is less reliable since it partly lacked data from the ETS positions variable in other samples from this area. Available sequences were identical for the two Hungarian samples and only one of them, 14HU, was included in the PCOA ordination.

Belarus, Lithuania and Poland

The two samples, 3BY and 4BY, belonging to the same population from Eastern Belarus had identical sequences, but only those from 3BY were complete. The position is rather isolated from other samples, but it appeared to be more closely related to the Lithuanian sample, 17LT, which in turn was most closely related to the sample from Pomerania in Northern Poland, 19PL, according to the PCOA ordination (Fig. 18), the positions of which were neither confirmed nor rejected by the parsimony analyses (Figs 1113). The second Polish population, from Silesia in southwestern Poland, 18PL, had an isolated position in the PCOA ordination, but its position was not confirmed in the phylogenetic analyses, probably because it lacked the trnL sequence (Table 4; Figs 12 and 13).

Germany

The genetic variation of betony in Germany is the largest of the 11 countries included in the study. The German samples were not closely related to each other, as seen in the phylogenetic analyses as well as in the PCOA ordination (Figs 1218), which cannot be explained by the fact that some of the German samples are geographically distant, and in some cases are closer to populations in neighboring countries (Fig. 10). The variation is large even between the two samples from Schleswig-Holstein, collected only a few kilometers from each other. Here, three autapomorphies were found in the ETS sequence of the sample from Dazendorf, 12DE. The same amount of variation was observed for the two samples from Sachsen, both collected in the Görlitz district, where 11DE had three autapomorphies in the ETS region (Table 4). Although these German samples are geographically closer to the populations in Denmark and southwestern Poland, there was no support for a direct relationship with these populations (Figs 1218).

Italy

Complete ETS and plastid DNA was obtained from a herbarium collection from 2003 from Northern Italy. This single Italian representative was characterized by one autapomorphy and a unique gap in the trnT–trnL region. There was no support for a close relationship with the geographically closest samples in France or Austria, neither in the phylogenetic trees nor in the PCOA ordination (Figs 1218).

Conclusion for Future Biology

Betony is decreasing in most parts of Europe due to the loss of habitats. The species is listed as endangered in several countries, among them Sweden and Denmark (Tyler et al., 2007, p. 471; Hartvig, 2015, pp. 613, 614). Except Kungsmarken in Södra Sandby parish in Skåne, where a successful rescue project has been undertaken, the number of individuals has slowly declined at the naturally occurring localities in Scandinavia. The decrease began a long time ago with the loss of open woods and meadows. The main threats today are intense forestry, inappropriate mowing, overgrowth, grazing by deer (mainly the flower stalks), and foraging by wild boars, which destroy the roots; the latter threat is probably the most severe one, at least in Scandinavia. However, the Kungsmarken locality project encouraged us to undertake new rescue projects to save the historically interesting populations, first and foremost in Stehag, where betony is documented since 1534, and at the roadside locality in Bjerremark on Lolland, where it was collected in 1853, according to a herbarium sheet kept in Lund (Thell, 2016b). Since 2017, local material is planted both at the localities and at backup localities followed by careful documentation. The conservation project started in Denmark where betony was most critically endangered and the decline had been most evident. Seeds were taken from the two remaining flowering plants in 2016 (Fig. 2). During the next 2 years, 100 seedlings were placed along the roadside in Bjerremark, of which most seem to survive much depending on a management plan that was established with the municipality of Lolland. Roadsides are the last retreat places in the modern farmland for many meadow plants and furthermore the roadside flora often suffers from too intensive care.

The results of this study, including the discovery of the “Skåne-duplication,” support the contention by Turesson (1930) that “spontaneous” betony populations probably exist in Scandinavia. These are reasons enough for protecting the remaining localities for the future and for providing backup localities through cultivation. Such localities are established both on municipal land in Stehag and in Denmark where a backup locality was founded at Kristiansminde field station of Copenhagen University in Sorø (Fig. 20).

Fig. 20.
Fig. 20.

Planting for the future. In addition to the supportive planting in Bjerremark, a backup locality for the rare Danish population was founded at Kristiansminde field station of Copenhagen University in Sorø. August 2018 (photo: N. Thell)

Citation: Biologia Futura BiolFut 70, 3; 10.1556/019.70.2019.27

A comparative cultivation of betony from various countries is constantly being expanded, where we use the same materials as in the genetic studies (Fig. 19). Flowering time and plant size will be compared, following Turesson (1930), but hopefully additional characters that offer infraspecific variation will be detected.

Next step in the genetic study is to examine a further improved set of samples using Next Generation Sequencing, namely, Restriction site Associated DNA sequencing, which we believe will provide an even more nuanced picture of the infraspecific variation of this beautiful species.

Acknowledgments

The authors are most grateful to collectors Siegmar Breckle (Bielefeld, Germany); Edit Farkas and László Lőkös (Vácrátót, Hungary); Petra Gebauer, Christiane Ritz and Karsten Wesche (Senckenberg Museum of Natural History, Görlitz); Marta Jarosińska and Katarzyna Wszałek-(Rożek, Herbarium UGDA, University of Gdansk); Jurga Motiejūnaitė (Institute of Botany, Nature Research Centre; Vilnius); Henrik Johansson, Rune Svensson and Åke Svensson (Lund Botanical Society); Åke Rühling and Torbjörn Tyler (Biological Museum, Lund); and Andrei Tsurykau (Gomel State University, Belarus), as well as numerous enthusiasts in Yorkshire, for making the collecting trip there so successful.

They would also like to thank Jan Thomas Johansson for general support and information about current taxonomy through many discussions and his impressive homepage The Phylogeny of Angiosperms (angio.bergianska.se); Lennart Engstrand (former superintendent in the Botanical Garden of Lund) for providing us with his exciting data from the rescue project at Kungsmarken, Dorthe Prip Lahrmann (Municipal Administration of Lolland, Denmark), Marianne Helkjær (Danish Botanical Association); Katrin Romahn and Simon Kellner (AG Geobotanik in Schleswig-Holstein & Hamburg e.V.) who provided coordinates for the localities in eastern Holstein (samples 12–13); Helena Persson (Botanical Garden, Lund University) who helped us with seed exchange with the Botanical Gardens in Nantes and Nancy, Ulf Schiefelbein (Rostock), who provided literature and a map of the distribution in Mecklenburg-Vorpommern; Finn Skovgaard for information and the important contact with M. Helkjær in Danish Botanical Society; Ulrik Søchting (Curator at Sorø Field Station, Copenhagen University); Emil Åsegård (Stehag) for providing seeds; and Nataliya Thell (Stehag) for making photographs.

They would like to extend their thanks to the Biological Museum of Lund University (LD) where we found samples fresh enough for the analyses; new samples were immediately incorporated and databased into the collections, and to Åke Rühling, responsible for the Oskarshamn herbarium (OHN), from where the two Austrian samples were borrowed.

Ethical Statement:

None.

Data Accessibility:

The materials are found at Virtuella herbariet, herbarium.emg,umu.se, and the sequences at National Center for Biotechnology Information (NCBI; ncbi.nlm.nih.gov).

Competing Interests:

The authors declare no competing interests.

Authors’ Contributions:

AT involved in idea of the study, evaluation of results, writing, submitting sequences, collecting, correspondence with other collectors. MaH involved in laboratory methods, writing, and reading. P-EP involved in laboratory work and evaluation of the results, collection, and writing of “Materials and Methods” section. MS contributed to historical and floristic parts and linguistic revisions. MV contributed to ecology and plant geography. MiH contributed to phylogenetic analyses, collecting, writing, and reading.

References

  • Allen, D. E., Hatfield, G. (2004) Medicinal Plants in Folk Tradition. An Ethnobotany of Britain and Ireland. Timber Press, Cambridge, MA.

    • Search Google Scholar
    • Export Citation
  • Almgren, K. (1909) Om förekomsten i Sollentuna socken af Betonica officinalis samt några andra botaniska anteckningar [On the occurrence of Betonica officinalis in Sollentuna parish and some other botanical notes]. Svensk Bot. Tidskr. 3, 1618.

    • Search Google Scholar
    • Export Citation
  • Almquist, S. (1909) Mera om förekomsten af Betonica officinalis i Sollentuna [More on the occurrence of Betonica officinalis in Sollentuna]. Svensk Bot. Tidskr. 3, 6869.

    • Search Google Scholar
    • Export Citation
  • Andersen, S. (1942) Sjældne Hedeplanter m. v. i Sydlolland. Dansk Bot [Rare heath plants in southern Lolland]. Tidskr 46, 152155.

  • Baldwin, B. G., Markos, S. (1998) Phylogenetic utility of the external transcribed spacer (ETS) of 18S–26SrDNA: congruence of ETS and ITS trees of Calycadenia (Compositae). Mol. Phyl. Evol. 10, 449463.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Beardsley, P., Olmstead, R. G. (2002) Redefining Phrymaceae: The placement of Mimulus tribe Mimulae, and Phryma . Am. J. Bot. 89, 10931102.

  • Bohs, L., Olmstead, R. G. (2001) A reassessment of Normania and Triguera (Solanaceae). Pl. Syst. Evol. 228, 3348.

  • Cavalli-Sforza, L. L., Edwards, A. W. (1967) Phylogenetic analysis. Models and estimation procedures. Am. J. Hum. Genet. 19, 233257.

    • Search Google Scholar
    • Export Citation
  • Culpeper, N. (1790) English Physician; and Complete Herbal (1st extended ed., in 1653). Printed for the author, London.

  • Demesure, B., Sodzi, N., Petit, R. J. (1995) A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Mol. Ecol. 4, 129131.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783791.

  • FloraWeb. (2018) Betonica officinalis subsp. officinalis L. Bundesamt für Naturschutz (BfN) [Federal Agency for Nature Conservation], Bonn. Retrieved from http://www.floraweb.de

    • Search Google Scholar
    • Export Citation
  • Fries, E. M. (1823) Vegetationens förändringar, jemte uppgift på sellsyntare vexter anmärkte i Skåne [Changes in vegetation, with notes on rare species observed in Skåne]. , den 6 Maj 1823, pp. 8495.

    • Search Google Scholar
    • Export Citation
  • Geiger, P. L. (1839) Pharmaceutische Botanik. Erste Hälfte [Pharmaceutic botany. First half] (2nd ed., rev.). Heidelberg, Winter.

  • Haeupler, H., Schönfelder, P. (1989) Atlas der Farn- und Blütenpflanzen der Bundesrepublik Deutschland [Altas of the ferns and flowering plants of the Federal Republic of Germany]. Ulmer, Stuttgart.

    • Search Google Scholar
    • Export Citation
  • Hall, B. G. (2013) Building phylogenetic trees from molecular data with MEGA. Mol. Biol. Evol. 30, 12291235.

  • Hamilton, M. B. (1999) Four primer pairs for the amplification of chloroplast intergenic regions with infraspecific variation. Mol. Ecol. 8, 521523.

    • Search Google Scholar
    • Export Citation
  • Hartvig, P. (2015) Atlas Flora Danica, Band 3. Gyldendal, Copenhagen, pp. 613614.

  • Hornemann, J. W. (1821) Førsøg til en dansk økonomisk Plantelære. 3e førøgede Oplag [Preliminary Danish economic botany] (3rd extended ed.). Copenhagen, Denmark.

    • Search Google Scholar
    • Export Citation
  • Hultén, E. (1971) Atlas över växternas utbredning i Norden. Fanerogamer och ormbunksväxter [Atlas of the plants in the Nordic countries. Phanerogams and ferns] (2nd ed.). Generalstabens litografiska anstalts förlag, Stockholm, Sweden.

    • Search Google Scholar
    • Export Citation
  • Jorgensen, R. A., Cluster, P. D. (1988) Modes and tempos in the evolution of nuclear ribosomal DNA: new characters for evolutionary studies and new markers for genetic and population studies. Ann. Missouri Bot. Garden 75, 12381247.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Karlsson, T. (1982) Euphrasia rostkoviana i Sverige. Växtekologiska studier 15 [Euphrasia rostkoviana in Sweden]. Svenska Växtgeografiska Sällskapet, Uppsala, Sweden.

    • Search Google Scholar
    • Export Citation
  • Kumar, S., Stecher, G., Tamura, K. (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 18701874.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kylling, P. (1688) Viridarium Danicum, sive Catalogus Trilingvis Latino-Danico-Germanicus Plantarum Indigenarum In Dania Observatarum qvarum cuiqve suus est additus Locus, qvo in primis nascatur [Danish plant catalogue in three languages, Latin, Danish and German, for plants native in Denmark, including localities]. Copenhagen.

    • Search Google Scholar
    • Export Citation
  • Larsson, H. A. (1987) Humlesugan, Stachys officinalis, ännu kvar i Stehag [Betony, Stachys officinalis, still present in Stehag]. Svensk Bot. Tidskr. 81, 111114.

    • Search Google Scholar
    • Export Citation
  • Leche, J. (1744) Primitiæ Floræ Scanicæ [First flora of Skåne]. Decreux, Lund, Sweden.

  • Lilja, N. (1838) Skånes Flora [Flora of Skåne]. Berlingska, Lund, Sweden.

  • Lilja, N. (1870) Skånes Flora. I–II [Flora of Skåne] (2nd ed., rev.). Hierta, Stockholm.

  • Linnæus, C. (1745) Flora Suecica. L. Salvius, Stockholm.

  • Linnæus, C. (1755) Flora Suecica. L. Salvius, Stockholm.

  • Mattiasson, G. (2010). Kungsmarken – flora och vegetation [Kungsmarken – flora and vegetation]. Bot. Notiser 143, 176.

  • Mierwald, U., Romahn, K. (2006) Die Farn-und Blütenpflanzen Schleswig-Holsteins. Rote Liste – Band 1 [The ferns and flowering plants of Schleswig-Holstein. Red List – Volume 1. State Office for Nature and Environment of Schleswig Holstein, Flintbek]. Landesamt für Natur und Umwelt des Landes Schleswig-Holstein, Flintbek.

    • Search Google Scholar
    • Export Citation
  • Müller, O. F. (1778) Flora Danica 13, plate 726. Copenhagen.

  • Ortus Sanitatis. (1517) R. Beck, Straßbourg (även känd som Hortus, utan författare, urasprungligen publicerad 1491 av J. Meydenbach, Mainz) [R. Beck, Straßbourg (also known as Hortus, originally published 1491 by J. Meydenbach, Mainz)].

    • Search Google Scholar
    • Export Citation
  • Parnell, J., Curtis, T. (2012) Webb’s an Irish flora. Cork University Press, Cork.

  • Paulli, S. (1648) Flora Danica Det er: Dansk Urtebog [Flora of Denmark, i.e., Danish herb book]. M. Marzan, Copenhagen.

  • Pedersen, A. (1969) Labiaternas og Verbenaceernes udbredelse i Danmark. TBU-dissertation n:r 37 [About herbal water]. Bot. Tidskr. 64, 285379.

    • Search Google Scholar
    • Export Citation
  • Pedersen, Ch. (1534) Om Urte Vand. Ch. Pedersen, Malmø.

  • Pillon, Y., Fay, M. F., Hedrén, M., Bateman, R. M., Devey, D., Shipunov, A., van der Bank, M., Chase, M. W. (2007) Evolution and temporal diversification of western European polyploid species complexes in Dactylorhiza (Orchidaceae). Taxon 2007, 11851208.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Prince, L. M., Kress, J. (2006) Phylogeny and biogeography of the prayer plant family: getting to the root problem in Maranthaceae. Aliso 22, 645659.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rohlf, F. J. (2005) NTSYSpc: Numerical Taxonomy System, Version 2.20. Exeter Publishing, Setauket, NY.

  • Rufelt, H. (1949) Bidrag till Skånes Flora. 42. Om flora och vegetation i Stehags socken [Additions to the Flora of Skåne. About flora and vegetation in Stehag parish]. Bot. Notiser 102, 109126.

    • Search Google Scholar
    • Export Citation
  • Salmaki, Y., Zarre, S., Ryding, O., Lindqvist, Ch., Bräuchler, Ch., Heubl, G., Barber, J., Bendiksby, M. (2013) Molecular phylogeny of tribe Stachyidae (Lamiaceae subfamily Lamoidae). Mol. Phyl. Evol. 69, 535551.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Salmaki, Y., Zarre, S, Ryding, O., Lindqvist, C., Scheunert, A., Brauchler, C., Heubl, G. (2012) Phylogeny of the tribe Phlomideae (Lamioideae: Lamiaceae) with special focus on Eremostachys and Phlomoides: new insights from nuclear and chloroplast sequences. Taxon 61, 161179.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Shaw, J., Lickey, E. B., Beck, J. T., Farmer, S. B., Liu, W., Miller, J., Siripun, K. C., Winder, C. T., Schilling, E. E., Small, R. L. (2005) The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am. J. Bot. 92, 142166.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Silveira, M. A., Simpson, M. G. (2013) Phylogenetics of the Mesa Mints: Popogyne (Lamiaceae). Syst. Bot. 38, 782794.

  • Stace, C. (2019) New Flora of the British Isles (4th ed.). C&M Floristics, Middlewood Green, Suffolk.

  • Stanford, A. M., Harden, R., Parks, C. R. (2000) Phylogeny and biogeography of Juglans (Juglandaceae) based on matK and ITS sequence data. Am. J. Bot. 87, 872882.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Taberlet, P., Gielly, L., Pautou, G., Bouvet, J. (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17, 11051109.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Thell, A. (2016a) Betony (Betonica officinalis) in Stehag – a piece of living plant history. In: Kandt, K. E., Lissok, M. (eds.) Festgaben aus Floras Füllhorn, Pomonas Gärten und vom Helikon. Eine Blütenlese kultur- und kunsthistorischer Beiträge zum 65. Geburtstag von Gerd-Helge Vogel [Gifts from Floras Cornucopia, Pomona's gardens and from the Helikon. A collection of cultural and art historical contributions on the occasion of the 65th birthday of Gerd-Helge Vogel]. Ludwig, Kiel, pp. 2237, and 225.

    • Search Google Scholar
    • Export Citation
  • Thell, A. (2016b) Humlesugan i Skåne and Danmark under 500 år [Betony in Skåne and Denmark for 500 years]. Bot. Notiser 149(4), 119.

    • Search Google Scholar
    • Export Citation
  • Turesson, G. (1930) Zur Frage nach der Spontaneität von Betonica officinalis L. in Schweden [The question of spontaneity of Betonica officinalis L. in Sweden]. Bot. Notiser 83, 495506.

    • Search Google Scholar
    • Export Citation
  • Tyler, T. (2015) Holma Ängar – en okänd lokal för humlesuga Betonica officinalis och många trevliga följearter [Holma ängar – an unknown locality for Betonica officinalis and many enjoyable accompanied species]. Bot. Notiser 148, 2932.

    • Search Google Scholar
    • Export Citation
  • Tyler, T., Olsson, K.-A., Johansson, H., Sonesson, M. (eds.) (2007) Skånes flora – arterna och deras utbredning [The flora of Skåne – the species and their distribution]. Grahns, Lund.

    • Search Google Scholar
    • Export Citation
  • Urbatsch, L. E., Baldwin, B. G., Donoghue, M. J. (2000) Phylogeny of the coneflowers and relatives (Heliantheae: Asteraceae) based on nuclear rDNA internal transcribed spacer (ITS) sequences and chloroplast DNA restriction site data. Syst. Bot. 25, 539565.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Weverinck, T. (1939) Gyabergsskogen [The Gyaberg Forest]. Skånes Natur 26, 4152.

  • White, T. J., Burns, T., Lee, S., Taylor, J. W. (1991) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M. A., Gelfand, D. H., Sninsky, J.-J., White, T. J. (eds.) PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, pp. 315322.

    • Search Google Scholar
    • Export Citation
  • Wollert, H. (2005) Zum standörtlichen und soziologischen Verhalten des Heilziest (Betonica officinalis L.) in Mecklenburg-Vorpommern [On the local and sociological conditions of betony in Mecklenburg-Vorpommern]. Botanischer Rundbrief für Mecklenburg-Vorpommern, Neubrandenburg 40, 1130.

    • Search Google Scholar
    • Export Citation
  • Zacharias, D., Janßen, C., Brandes, D. (1988) Basenreiche Pfeifengras-Streuewiesen des Molinietum coeruleae W. Koch 1926, ihre Brachstadien und ihre wichtigsten Kontaktgesellschaften in Südost-Niedersachsen [Base-rich moor grass meadows of the Molinietum caeruleae W. Koch, their fallow stages and their most important associated societies in southeastern Lower Saxony]. Tuexenia 8, 5578.

    • Search Google Scholar
    • Export Citation
  • Zimmermann, F. (2014) Pfeifengraswiesen auf kalkreichem Boden, torfigen und tonig-schluffigen Böden (Molinion caeruleae) [Moor grass meadows on calcareous ground, peat and silty-clay ground (Molinion caeruleae)]. Naturschutz und Landschaftspflege in Brandenburg 23, 8285.

    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

  • Allen, D. E., Hatfield, G. (2004) Medicinal Plants in Folk Tradition. An Ethnobotany of Britain and Ireland. Timber Press, Cambridge, MA.

    • Search Google Scholar
    • Export Citation
  • Almgren, K. (1909) Om förekomsten i Sollentuna socken af Betonica officinalis samt några andra botaniska anteckningar [On the occurrence of Betonica officinalis in Sollentuna parish and some other botanical notes]. Svensk Bot. Tidskr. 3, 1618.

    • Search Google Scholar
    • Export Citation
  • Almquist, S. (1909) Mera om förekomsten af Betonica officinalis i Sollentuna [More on the occurrence of Betonica officinalis in Sollentuna]. Svensk Bot. Tidskr. 3, 6869.

    • Search Google Scholar
    • Export Citation
  • Andersen, S. (1942) Sjældne Hedeplanter m. v. i Sydlolland. Dansk Bot [Rare heath plants in southern Lolland]. Tidskr 46, 152155.

  • Baldwin, B. G., Markos, S. (1998) Phylogenetic utility of the external transcribed spacer (ETS) of 18S–26SrDNA: congruence of ETS and ITS trees of Calycadenia (Compositae). Mol. Phyl. Evol. 10, 449463.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Beardsley, P., Olmstead, R. G. (2002) Redefining Phrymaceae: The placement of Mimulus tribe Mimulae, and Phryma . Am. J. Bot. 89, 10931102.

  • Bohs, L., Olmstead, R. G. (2001) A reassessment of Normania and Triguera (Solanaceae). Pl. Syst. Evol. 228, 3348.

  • Cavalli-Sforza, L. L., Edwards, A. W. (1967) Phylogenetic analysis. Models and estimation procedures. Am. J. Hum. Genet. 19, 233257.

    • Search Google Scholar
    • Export Citation
  • Culpeper, N. (1790) English Physician; and Complete Herbal (1st extended ed., in 1653). Printed for the author, London.

  • Demesure, B., Sodzi, N., Petit, R. J. (1995) A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Mol. Ecol. 4, 129131.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783791.

  • FloraWeb. (2018) Betonica officinalis subsp. officinalis L. Bundesamt für Naturschutz (BfN) [Federal Agency for Nature Conservation], Bonn. Retrieved from http://www.floraweb.de

    • Search Google Scholar
    • Export Citation
  • Fries, E. M. (1823) Vegetationens förändringar, jemte uppgift på sellsyntare vexter anmärkte i Skåne [Changes in vegetation, with notes on rare species observed in Skåne]. , den 6 Maj 1823, pp. 8495.

    • Search Google Scholar
    • Export Citation
  • Geiger, P. L. (1839) Pharmaceutische Botanik. Erste Hälfte [Pharmaceutic botany. First half] (2nd ed., rev.). Heidelberg, Winter.

  • Haeupler, H., Schönfelder, P. (1989) Atlas der Farn- und Blütenpflanzen der Bundesrepublik Deutschland [Altas of the ferns and flowering plants of the Federal Republic of Germany]. Ulmer, Stuttgart.

    • Search Google Scholar
    • Export Citation
  • Hall, B. G. (2013) Building phylogenetic trees from molecular data with MEGA. Mol. Biol. Evol. 30, 12291235.

  • Hamilton, M. B. (1999) Four primer pairs for the amplification of chloroplast intergenic regions with infraspecific variation. Mol. Ecol. 8, 521523.

    • Search Google Scholar
    • Export Citation
  • Hartvig, P. (2015) Atlas Flora Danica, Band 3. Gyldendal, Copenhagen, pp. 613614.

  • Hornemann, J. W. (1821) Førsøg til en dansk økonomisk Plantelære. 3e førøgede Oplag [Preliminary Danish economic botany] (3rd extended ed.). Copenhagen, Denmark.

    • Search Google Scholar
    • Export Citation
  • Hultén, E. (1971) Atlas över växternas utbredning i Norden. Fanerogamer och ormbunksväxter [Atlas of the plants in the Nordic countries. Phanerogams and ferns] (2nd ed.). Generalstabens litografiska anstalts förlag, Stockholm, Sweden.

    • Search Google Scholar
    • Export Citation
  • Jorgensen, R. A., Cluster, P. D. (1988) Modes and tempos in the evolution of nuclear ribosomal DNA: new characters for evolutionary studies and new markers for genetic and population studies. Ann. Missouri Bot. Garden 75, 12381247.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Karlsson, T. (1982) Euphrasia rostkoviana i Sverige. Växtekologiska studier 15 [Euphrasia rostkoviana in Sweden]. Svenska Växtgeografiska Sällskapet, Uppsala, Sweden.

    • Search Google Scholar
    • Export Citation
  • Kumar, S., Stecher, G., Tamura, K. (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 18701874.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Kylling, P. (1688) Viridarium Danicum, sive Catalogus Trilingvis Latino-Danico-Germanicus Plantarum Indigenarum In Dania Observatarum qvarum cuiqve suus est additus Locus, qvo in primis nascatur [Danish plant catalogue in three languages, Latin, Danish and German, for plants native in Denmark, including localities]. Copenhagen.

    • Search Google Scholar
    • Export Citation
  • Larsson, H. A. (1987) Humlesugan, Stachys officinalis, ännu kvar i Stehag [Betony, Stachys officinalis, still present in Stehag]. Svensk Bot. Tidskr. 81, 111114.

    • Search Google Scholar
    • Export Citation
  • Leche, J. (1744) Primitiæ Floræ Scanicæ [First flora of Skåne]. Decreux, Lund, Sweden.

  • Lilja, N. (1838) Skånes Flora [Flora of Skåne]. Berlingska, Lund, Sweden.

  • Lilja, N. (1870) Skånes Flora. I–II [Flora of Skåne] (2nd ed., rev.). Hierta, Stockholm.

  • Linnæus, C. (1745) Flora Suecica. L. Salvius, Stockholm.

  • Linnæus, C. (1755) Flora Suecica. L. Salvius, Stockholm.

  • Mattiasson, G. (2010). Kungsmarken – flora och vegetation [Kungsmarken – flora and vegetation]. Bot. Notiser 143, 176.

  • Mierwald, U., Romahn, K. (2006) Die Farn-und Blütenpflanzen Schleswig-Holsteins. Rote Liste – Band 1 [The ferns and flowering plants of Schleswig-Holstein. Red List – Volume 1. State Office for Nature and Environment of Schleswig Holstein, Flintbek]. Landesamt für Natur und Umwelt des Landes Schleswig-Holstein, Flintbek.

    • Search Google Scholar
    • Export Citation
  • Müller, O. F. (1778) Flora Danica 13, plate 726. Copenhagen.

  • Ortus Sanitatis. (1517) R. Beck, Straßbourg (även känd som Hortus, utan författare, urasprungligen publicerad 1491 av J. Meydenbach, Mainz) [R. Beck, Straßbourg (also known as Hortus, originally published 1491 by J. Meydenbach, Mainz)].

    • Search Google Scholar
    • Export Citation
  • Parnell, J., Curtis, T. (2012) Webb’s an Irish flora. Cork University Press, Cork.

  • Paulli, S. (1648) Flora Danica Det er: Dansk Urtebog [Flora of Denmark, i.e., Danish herb book]. M. Marzan, Copenhagen.

  • Pedersen, A. (1969) Labiaternas og Verbenaceernes udbredelse i Danmark. TBU-dissertation n:r 37 [About herbal water]. Bot. Tidskr. 64, 285379.

    • Search Google Scholar
    • Export Citation
  • Pedersen, Ch. (1534) Om Urte Vand. Ch. Pedersen, Malmø.

  • Pillon, Y., Fay, M. F., Hedrén, M., Bateman, R. M., Devey, D., Shipunov, A., van der Bank, M., Chase, M. W. (2007) Evolution and temporal diversification of western European polyploid species complexes in Dactylorhiza (Orchidaceae). Taxon 2007, 11851208.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Prince, L. M., Kress, J. (2006) Phylogeny and biogeography of the prayer plant family: getting to the root problem in Maranthaceae. Aliso 22, 645659.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rohlf, F. J. (2005) NTSYSpc: Numerical Taxonomy System, Version 2.20. Exeter Publishing, Setauket, NY.

  • Rufelt, H. (1949) Bidrag till Skånes Flora. 42. Om flora och vegetation i Stehags socken [Additions to the Flora of Skåne. About flora and vegetation in Stehag parish]. Bot. Notiser 102, 109126.

    • Search Google Scholar
    • Export Citation
  • Salmaki, Y., Zarre, S., Ryding, O., Lindqvist, Ch., Bräuchler, Ch., Heubl, G., Barber, J., Bendiksby, M. (2013) Molecular phylogeny of tribe Stachyidae (Lamiaceae subfamily Lamoidae). Mol. Phyl. Evol. 69, 535551.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Salmaki, Y., Zarre, S, Ryding, O., Lindqvist, C., Scheunert, A., Brauchler, C., Heubl, G. (2012) Phylogeny of the tribe Phlomideae (Lamioideae: Lamiaceae) with special focus on Eremostachys and Phlomoides: new insights from nuclear and chloroplast sequences. Taxon 61, 161179.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Shaw, J., Lickey, E. B., Beck, J. T., Farmer, S. B., Liu, W., Miller, J., Siripun, K. C., Winder, C. T., Schilling, E. E., Small, R. L. (2005) The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am. J. Bot. 92, 142166.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Silveira, M. A., Simpson, M. G. (2013) Phylogenetics of the Mesa Mints: Popogyne (Lamiaceae). Syst. Bot. 38, 782794.

  • Stace, C. (2019) New Flora of the British Isles (4th ed.). C&M Floristics, Middlewood Green, Suffolk.

  • Stanford, A. M., Harden, R., Parks, C. R. (2000) Phylogeny and biogeography of Juglans (Juglandaceae) based on matK and ITS sequence data. Am. J. Bot. 87, 872882.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Taberlet, P., Gielly, L., Pautou, G., Bouvet, J. (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17, 11051109.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Thell, A. (2016a) Betony (Betonica officinalis) in Stehag – a piece of living plant history. In: Kandt, K. E., Lissok, M. (eds.) Festgaben aus Floras Füllhorn, Pomonas Gärten und vom Helikon. Eine Blütenlese kultur- und kunsthistorischer Beiträge zum 65. Geburtstag von Gerd-Helge Vogel [Gifts from Floras Cornucopia, Pomona's gardens and from the Helikon. A collection of cultural and art historical contributions on the occasion of the 65th birthday of Gerd-Helge Vogel]. Ludwig, Kiel, pp. 2237, and 225.

    • Search Google Scholar
    • Export Citation
  • Thell, A. (2016b) Humlesugan i Skåne and Danmark under 500 år [Betony in Skåne and Denmark for 500 years]. Bot. Notiser 149(4), 119.

    • Search Google Scholar
    • Export Citation
  • Turesson, G. (1930) Zur Frage nach der Spontaneität von Betonica officinalis L. in Schweden [The question of spontaneity of Betonica officinalis L. in Sweden]. Bot. Notiser 83, 495506.

    • Search Google Scholar
    • Export Citation
  • Tyler, T. (2015) Holma Ängar – en okänd lokal för humlesuga Betonica officinalis och många trevliga följearter [Holma ängar – an unknown locality for Betonica officinalis and many enjoyable accompanied species]. Bot. Notiser 148, 2932.

    • Search Google Scholar
    • Export Citation
  • Tyler, T., Olsson, K.-A., Johansson, H., Sonesson, M. (eds.) (2007) Skånes flora – arterna och deras utbredning [The flora of Skåne – the species and their distribution]. Grahns, Lund.

    • Search Google Scholar
    • Export Citation
  • Urbatsch, L. E., Baldwin, B. G., Donoghue, M. J. (2000) Phylogeny of the coneflowers and relatives (Heliantheae: Asteraceae) based on nuclear rDNA internal transcribed spacer (ITS) sequences and chloroplast DNA restriction site data. Syst. Bot. 25, 539565.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Weverinck, T. (1939) Gyabergsskogen [The Gyaberg Forest]. Skånes Natur 26, 4152.

  • White, T. J., Burns, T., Lee, S., Taylor, J. W. (1991) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M. A., Gelfand, D. H., Sninsky, J.-J., White, T. J. (eds.) PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, pp. 315322.

    • Search Google Scholar
    • Export Citation
  • Wollert, H. (2005) Zum standörtlichen und soziologischen Verhalten des Heilziest (Betonica officinalis L.) in Mecklenburg-Vorpommern [On the local and sociological conditions of betony in Mecklenburg-Vorpommern]. Botanischer Rundbrief für Mecklenburg-Vorpommern, Neubrandenburg 40, 1130.

    • Search Google Scholar
    • Export Citation
  • Zacharias, D., Janßen, C., Brandes, D. (1988) Basenreiche Pfeifengras-Streuewiesen des Molinietum coeruleae W. Koch 1926, ihre Brachstadien und ihre wichtigsten Kontaktgesellschaften in Südost-Niedersachsen [Base-rich moor grass meadows of the Molinietum caeruleae W. Koch, their fallow stages and their most important associated societies in southeastern Lower Saxony]. Tuexenia 8, 5578.

    • Search Google Scholar
    • Export Citation
  • Zimmermann, F. (2014) Pfeifengraswiesen auf kalkreichem Boden, torfigen und tonig-schluffigen Böden (Molinion caeruleae) [Moor grass meadows on calcareous ground, peat and silty-clay ground (Molinion caeruleae)]. Naturschutz und Landschaftspflege in Brandenburg 23, 8285.

    • Search Google Scholar
    • Export Citation

Acta Biologica Hungarica at Indexing/Ranking Services:

  • Impact Factor (2018): 0.679
  • Environmental Science (miscellaneous) SJR Quartile Score (2018): Q3
  • Biochemistry, Genetics and Molecular Biology (miscellaneous) SJR Quartile Score (2018): Q3
  • Scimago Journal Rank (2018): 0.261
  • SJR Hirsch-Index (2018): 25

Language: English

Founded in 1950
Siize: A4
Publication: One volume of four issues annually
Publication Programme: 2020. Vol. 71.
Indexing and Abstracting Services:

  • Biological Abstracts
  • BIOSIS Previews
  • CAB Abstracts/li>
  • Current Abstracts
  • Current Contents: Agriculture
  • Biology and Environmental Sciences
  • Elsevier BIOBASE
  • Global Health
  • Index Madicus
  • Index Veterinarius
  • Medline
  • Referativnyi Zhurnal
  • Science Citation Index
  • Science Citation Index Expanded (SciSearch)
  • SCOPUS
  • The ISI Alerting Services
  • Zoological Abstracts

 

Subscribers can access the electronic version of every printed article.

Senior Editors

Editor-in-Chief: Miklósi, Ádám

Managing Editor: Molnár, Csaba

Editorial Board

Maász, Gábor - Hungarian Academy of Sciences, Centre for Ecological Research
Barina, Zoltán - Hungarian Natural History Museum, Department of Botany
Pongrácz, Péter - Eötvös Loránd University, Department of Ethology
Gábriel, Róbert - University of Pécs, Szentágothai Research Centre
Vágvölgyi, Csaba - University of Szeged, Department of Microbiology
Hideg, Éva - University of Pécs, Department of Plant Biology
Solti, Ádám - Eötvös Loránd University, Department of Plan Physiology and Molecular Plant Biology
Erős, Tibor - Hungarian Academy of Sciences, Centre for Ecological Research
Székely, Tamás - University of Bath, University of Debrecen
Dobolyi, Árpád - Eötvös Loránd University, Department of Neurobiology and Physiology
Tamás, Andrea - University of Pécs, Department of Anatomy
Kovács, Tibor - Eötvös Loránd University, Department of Genetics
Serfőző, Zoltán - Hungarian Academy of Sciences, Balaton Limnological Institute
Bede-Fazekas, Ákos - Hungarian Academy of Sciences, Centre for Ecological Research
Bugyi, Beáta - University of Pécs, Department of Biophysics
Fugazza, Claudia - Eötvös Loránd University, Department of Ethology
Chmura, Damjan - University of Bielsko-Biala, Institute of Environmental Protection and Engineering
Neugart, Susanne - Leibniz Institute of Vegetable and Ornamental Crops
Contardo-Jara, Valeska - Technical University of Berlin, Institute of Ecology

The submission template is available as an MS WORD docx.

Please, download the file from HERE