Authors:
Júlia Hegyi-Kaló Food and Wine Research Institute, Eszterházy Károly Catholic University, Leányka utca 8., H-3300 Eger, Hungary

Search for other papers by Júlia Hegyi-Kaló in
Current site
Google Scholar
PubMed
Close
,
Richárd Golen Food and Wine Research Institute, Eszterházy Károly Catholic University, Leányka utca 8., H-3300 Eger, Hungary

Search for other papers by Richárd Golen in
Current site
Google Scholar
PubMed
Close
,
Zoltán Karácsony Food and Wine Research Institute, Eszterházy Károly Catholic University, Leányka utca 8., H-3300 Eger, Hungary

Search for other papers by Zoltán Karácsony in
Current site
Google Scholar
PubMed
Close
,
Adrienn Gomba-Tóth Food and Wine Research Institute, Eszterházy Károly Catholic University, Leányka utca 8., H-3300 Eger, Hungary

Search for other papers by Adrienn Gomba-Tóth in
Current site
Google Scholar
PubMed
Close
,
Thomas Cels Food and Wine Research Institute, Eszterházy Károly Catholic University, Leányka utca 8., H-3300 Eger, Hungary

Search for other papers by Thomas Cels in
Current site
Google Scholar
PubMed
Close
,
Ádám István Hegyi Food and Wine Research Institute, Eszterházy Károly Catholic University, Leányka utca 8., H-3300 Eger, Hungary

Search for other papers by Ádám István Hegyi in
Current site
Google Scholar
PubMed
Close
, and
Kálmán Zoltán Váczy Food and Wine Research Institute, Eszterházy Károly Catholic University, Leányka utca 8., H-3300 Eger, Hungary

Search for other papers by Kálmán Zoltán Váczy in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-8303-5887
Open access

Abstract

Botrytis cinerea is one of the fungal pathogens with the widest host plant spectrum, causing serious yield losses and significant economic damage in vineyards from year to year. As an ubiquitous, polyphagous fungal pathogen, with both saprophytic and parasitic lifestyle. The sequential use of active substances belonging to the same chemical family to protect vineyards can lead to an increase in fungal chemical resistance, which is reflected in the enrichment of point mutations in the genomic regions coding proteins involved in the mechanism of action of different pesticides. The aim of our studies was to compare the sensitivity to different fungicides of B. cinerea populations in two wine regions with different pest management practices: the Tokaj region, where the presence of B. cinerea is necessary to produce noble rot wines, and the adjacent Eger Region, where a total protection against B. cinerea is desired. Our study is the first Hungarian report of some previously studied resistance mutations in ERG27 and SDHB protein-coding genes. We identified point mutations in ERG27 transmembrane domain that have not been previously described but may affect the emergence of resistance to certain fungicides. Our study shows that the B. cinerea population of the Northern Hungary region is consistently characterized by an increase in fenhexamid resistance.

Abstract

Botrytis cinerea is one of the fungal pathogens with the widest host plant spectrum, causing serious yield losses and significant economic damage in vineyards from year to year. As an ubiquitous, polyphagous fungal pathogen, with both saprophytic and parasitic lifestyle. The sequential use of active substances belonging to the same chemical family to protect vineyards can lead to an increase in fungal chemical resistance, which is reflected in the enrichment of point mutations in the genomic regions coding proteins involved in the mechanism of action of different pesticides. The aim of our studies was to compare the sensitivity to different fungicides of B. cinerea populations in two wine regions with different pest management practices: the Tokaj region, where the presence of B. cinerea is necessary to produce noble rot wines, and the adjacent Eger Region, where a total protection against B. cinerea is desired. Our study is the first Hungarian report of some previously studied resistance mutations in ERG27 and SDHB protein-coding genes. We identified point mutations in ERG27 transmembrane domain that have not been previously described but may affect the emergence of resistance to certain fungicides. Our study shows that the B. cinerea population of the Northern Hungary region is consistently characterized by an increase in fenhexamid resistance.

Introduction

Botrytis cinerea is a well-known plant pathogenic fungus, infecting more than 1,200 different host plants (Elad et al., 2016), resulting in significant economic damage to agriculture. In the case of grapevines, it is also known as a two-faced fungus, as it is one of the most important pathogens of grapes, but it is also responsible for noble rot, necessary for the production of unique wines like Tokaji aszú, the earliest protected wine product in the world. For a long time, cell wall-degrading enzymes and toxins secreted by the fungus were attributed to the development of the infection pathway, but a rich toolbox of B. cinerea pathogenicity has now been described, revealing multiple infection pathways contributing to disease development.

In addition to reducing environmental impact and focusing on precision pesticide application, technology developers in crop protection practice are also concerned with the resistance of pathogens to pesticides. Practices that use the same pesticide active ingredient over a long period can very quickly cause a loss of sensitivity or resistance in the targeted pathogens. Resistance is one of the biggest threats posed by the widespread use of pesticides today, making pest management even more difficult (Lucas et al., 2015).

However, synthetic plant protection products have an important role in achieving the objectives of the European Union on plant health and food safety. Meanwhile, their excessive or otherwise inappropriate use can have adverse effects on soil, water, and agricultural biodiversity, with an additional threat to plant, animal, and human health. The European Commission has set ambitious targets for the sustainable use of pesticides as part of its Common Agricultural Policy (CAP) (Alexoaei et al., 2022).

Over the past decades, studies investigated the efficacy of pathogen-specific pesticides. In this area, B. cinerea was the first pathogen found to be resistant in a significant share of the field population. It soon became evident that the emergence of resistance depends on a wide range of biotic and abiotic factors, such as the chemical mode of action, the reproductivity of the targeted pathogen, and the frequency of fungicide application. In the case of B. cinerea, the frequency of application is the major determinant of resistance (Hahn, 2014).

Hydroxyamide fenhexamid, a Class III sterol biosynthesis inhibitor is one of the most used fungicides against B. cinerea worldwide (keto-reductase inhibitor, FRAC Code 17). It acts by inhibiting the 3-ketoreductase (ERG27) enzyme in the ergosterol biosynthesis pathway. This site-specific mode of action carries the risk of resistance and several studies have been conducted on which point mutations cause reduced susceptibility or resistance in the pathogen strains and the prevalence of these resistant strains in vineyards (Fillinger et al., 2008; Grabke et al., 2013).

Several amino acid substitutions have been identified that are responsible for resistance to certain classes of pesticides. Some of these are stable in the genome of the population during the reproduction of the pathogen and can be considered dominant mutations in certain areas or even worldwide (Leroux et al., 2010; Fillinger et al., 2016). In addition to the resistance against the ketoreductase-inhibitor pesticide, resistance can easily develop to the novel 14α-demethylase-inhibitor (DMI) pesticides by the mutation of the CYP51 gene (Harper et al., 2022). CYP51 (Erg11) belongs to the cytochrome P450 monooxygenase (CYP) superfamily and mediates a crucial step of the synthesis of ergosterol. In B. cinerea the CYP51B paralog was detected by Hawkins et al. (2014). The third most used group of pesticides against B. cinerea is SDHI (succinate-dehydrogenase inhibitor, FRAC Code 7), whose effectiveness is also reduced by a mutation, causing an amino acid substitution on the SDHB protein (Amiri et al., 2014).

In this study we investigated resistance markers in B. cinerea populations of two wine regions in Northern Hungary, Eger and Tokaj. To the best of our knowledge, a limited number of studies have been carried out in the last few years on such characteristics of Hungarian B. cinerea populations (Váczy et al., 2006; Asadollahi et al., 2010; Szojka et al., 2011). The selection of the wine regions that represent the sampling sites is an important factor. The wine regions of Eger and Tokaj were chosen due to the different pest management strategies applied by grape growers in these two regions against B. cinerea. In the Eger wine-growing region, B. cinerea is mostly considered a harmful pathogen causing serious yield losses, and therefore targeted pesticides are applied during the whole vegetation period. In contrast, in the Tokaj wine-growing region, B. cinerea causes the so-called noble rot on grapes in certain years. This process results in shriveled, raisin-like berries, with a very high sugar content, utilized in the making of sweet, noble rot wines. This process occurs about four to six times in ten years. Since it is not possible to determine whether a given vintage is suitable for aszú production, many aszú wine producers apply limited or no protection against B. cinerea during the last part of the plant protection period. This practice leads to the loss of raw material for other wines, but the tradition of aszú making and the uniqueness of the aszú wine encourages producers to take this risk.

This study aims to investigate the occurrence of pesticide resistance in B. cinerea populations in the two largest wine-growing regions of Northern Hungary. In addition, mutations that are possibly responsible for the detected resistant phenotypes were also examined. By comparing the resistance of the B. cinerea populations in the Eger and Tokaj-Hegyalja wine regions, we are not only contrasting two geographical areas, but the two above mentioned plant protection practices, which, in Tokaj sweet wine producing vineyards, contributes the development of B. cinerea noble rot.

Material and methods

Sampling was carried out in two vineyards in the Eger wine region (Mácsalma denoted Eger1 and Csájszél denoted Eger2 in Szomolya village) and two vineyards in the Tokaj wine region (Betsek denoted Tokaj1 and Szent Tamás denoted Tokaj2 in Mád village) in Northern Hungary, in 2015, 2017 and 2020. Grape berries covered with B. cinerea mycelia were collected randomly from Vitis vinifera cv. Furmint in Tokaj and cv. Olaszrizling in Csájszél and cv. Turán in Mácsalma during harvest time (late September to early October) resulting in a total of 250 berry samples. Collected berries were aseptically stored in 50 mL tubes which were placed on ice and taken to the microbiology laboratory.

Conidia from the berries were directly sprinkled onto Dichloran Rose Bengal chloramphenicol (DRBC) agar medium. Cultures were incubated at 25 °C in the dark and checked daily for mycelia development. Colonies with morphology similar to B. cinerea were used for the preparation of conidial suspension in distilled water. Suspensions were streaked on the surface of DRBC plates and the process was repeated once with developed separate colonies to obtain pure cultures. The isolates were subcultured on PDA medium, at 25 °C, and were preserved in 50 v/v% glycerol at −80 °C. Fungi were identified according to morphological characteristics. A total of 196 B. cinerea isolates were collected. Based on the morphological characters, it is not possible to distinguish B. cinerea from Botrytis pseudocienrea. Previous studies (Plesken et al., 2015) have described that pseudocinerea co-occurs with cinerea, but usually at a lower frequency. It is also mentioned that pseudocinerea can become dominant in certain host plants, but this phenomenon has not been described in grapes. On cultivated strawberries, it was frequently found in spring but was largely displaced by B. cinerea following fungicide applications. These data suggest, and our previous experience has shown, that the isolates collected are most likely to be of cinerea species. The isolates were tested by the gradient plate method for sensitivity against three different commercially available fungicidal agents (fenhexamid, tebuconazole and fluopyram + tebuconazole combination). The gradient plate method wascompared with the widely used agar dilution method in a previous study (Hegyi-Kaló et al., 2018), which demonstrated the accuracy of our gradient method protocol. B. cinerea strains were grown on toothpicks by placing them on PDA plates previously inoculated with a mycelial disk of the fungus. Cultures were incubated at 25 °C until the mycelia completely covered the medium. To prepare the fungicidal gradient medium, 15 mL of PDA medium amended with different concentrations of fungicidal solutions was poured into a tilted petri dish, followed by the addition of an equal volume of PDA in a horizontal position, after the solidification of the first layer. Thus, a medium with a linear gradient between zero and a given maximum concentration was obtained. A wide range of maximum concentrations was used (from 0.05 to 10 μg mL−1) to estimate the EC50 values for each isolate and fungicide. In addition to the intoxicated media, inoculated toothpicks were also placed on PDA as a control to determine the growth rate of each B. cinerea isolate in the absence of fungicides. The fungicide concentration at the point of 50% growth of the control sample could be calculated from the maximal concentration of the bottom layer of the gradient plate, since its thickness was assumed to be proportional to the resulting combined concentration, i.e. a linear concentration distribution (see Fig. 1). After the determination of the EC50 values, the strains that fell in the upper quartile according to the values for each fungicide were selected for molecular studies. DNA was isolated from these samples by thermolysis method. The B. cinerea strains were grown on PDA plates at 25 °C, and a small amount of mycelium was suspended in 100 μl of distilled water in a 1.5 mL microcentrifuge tube. The mixture was vortexed thoroughly and then centrifuged at 10,000 g for 1 min. After carefully discarding the supernatant, 400 μl of lysis solution (5 v/v% glycerol + 1 × TAE) was added to the microcentrifuge tube. The mixture was finally incubated at 85 °C in heat plate for 30 min. The lysate was centrifugated at 10,000 g for 5 min. A 100 μl portion of the supernatant was transferred in a new microcentrifuge tube and stored at −20 °C until further use as a template in the PCR reactions. Three sequences coding the Erg27, SdhB, and Cyp51 proteins were selected as possible bearers of resistance mutations. The different loci were PCR amplified with their corresponding primers using the following settings for erg27, sdhB and cyp51 genes case, respectively: initial preheating 95 °C – 3 min, 98 °C – 0.5 min and 95 °C – 3 min; denaturation 95 °C – 30 s, 98 °C – 5 s and 95 °C – 30 s; annealing 58 °C – 30 s, 59 °C – 5 s and 58 °C – 45 s; extending 72 °C – 1 min for each; repeat 35 × for each. The oligonucleotide sequences used for PCR amplification are listed in Table 1. Previously designed primers were applied in the reactions: the erg27 primer-pair was designed by Fillinger et al. (2008), the sdhB by Fournier et al. (2005) and the sdhB by Leroux et al. (2010).

Fig. 1.
Fig. 1.

Botrytis cinerea isolate growing on gradient plate (subfigure A) at 25 °C temperature 96 h post inoculation with tebuconazole was added to the bottom PDA medium of 0.2 ug mL−1 concentration. On the control petri dish (subfigure B) the growth was 41 mm, thus EC50 concentration can be estimated where the growth of the colony is 20.5 mm, marked on the figure. The average of the concentration value on both sides of the toothpick gives the EC50 value

Citation: Acta Phytopathologica et Entomologica Hungarica 59, 1; 10.1556/038.2024.00205

Table 1.

The sequences of the used oligonucleotide pairs

Primer nameTarget locusSequenceAnnealing temperature
erg27Begerg27ForwardTGGGATTACCACCATGGGAGACAAGTG58 °C
erg27EndReverseCAATGGTTCCGCATTTCTTTGCCTCCC
Begcyp51ForwardTGCGATGGGGATTCTTGAAC59 °C
EndReverseTTATCGTCGCTCCCAAGCTAC
IpBcBeg-FsdhBForwardCCACTCCTCCATAATGGCTGCTCTCCGC58 °C
IpBecEnd2-RReverseCTCATCAAGCCCCCTCATTGATATC

The amplified DNA was sequenced by Eurofins Genomics Germany Gmbh (Ebersberg, Germany) with Sanger's method result in raw “.fasta” files. Libraries were filtered and preprocessed by SnapGene software (www.snapgene.com). The identified nucleotide sequences were translated into amino acid sequences using Jaelview 2 software (Waterhouse et al., 2009) and the location of point mutations and amino acid substitutions were determined The sequences are deposited in the NCBI GenBank database under PP587884 – PP587936, PP587937 – PP587985 and PP587986 – PP588055 accession numbers.

For statistical analysis of the data, the vegan package (Oksansen et al., 2007) of the R programming language was used. EC50 values determined for different sampling sites were compared using ANOVA and significant differences between locations were also determined using Tukey's HSD test.

Results

In the present study, the tolerance of B. cinerea isolates from two wine regions of Northern Hungary to three commercially available fungicides were determined. Point mutations in certain genes of the isolates that may affect the resistance were also investigated.

Using the gradient plate method, EC50 values for different fungicides were determined for each B. cinerea isolate. The distribution of the values is shown as boxplots in Fig. 2. It can be clearly seen, that in the case of fenhexamid, Tokaj2 site showed an increased resistance compared to Tokaj1 and Eger2 with a large variability in EC50 values. Using tebuconazole as fungicide in the plate media the Tokaj2 isolates show significantly lower EC50 values, contrary to fenhexamid. Regarding the combined fungicide media Tokaj1 showed significantly higher sensitivity of strains than both Eger sites, which trend can be found about the other two fungicides with less significance (Fig. 2).

Fig. 2.
Fig. 2.

Boxplots of measured EC50 values of the isolates in case of different fungicides. Letters in the boxes shows the significant differences of the Tukey HSD test. Colored, shapes are showing the EC50 values of the isolates in case of which point mutations were identified (see the legend to identify)

Citation: Acta Phytopathologica et Entomologica Hungarica 59, 1; 10.1556/038.2024.00205

From the most tolerant 25% of the isolates we sequenced (the most tolerant 49 pcs of isolates resulted by each fungicide tests) three genes that can carry mutations resulting in the observed resistant phenotype. In Table 2 the found point mutations are listed. The amino acid substitution from phenylalanine to serine at position 412 of the Erg27 protein (F412S) was found in all sequenced isolates. We found at position 369 an asparagine to asparagic acid mutation (N369D) regarding to two isolates in both Eger1 and Eger2 sites (B15-Or193, B15-Or 1, B15-Tu 45, B15-Tu 173). This point mutation is the so-called HydR3− mutant showing reduced pathogenicity and other fitness parameters without selective pressure isolated from several Chilean, North American, French and German vineyards (Weber, 2010; Billard et al., 2011; Esterio et al., 2011; Moorman et al., 2012). The mutation histidine to arginine at position 272 (H272R) in the gene sdhB was reported from French vineyards in 2010 (Leroux et al., 2010) and Chilean table grapes in 2015 (Esterio et al., 2015) which caused boscalid resistance in B. cinerea strains. We identified this variant in one Eger1 isolate (B15-Tu 260), and it was also found in Australia and Italy (Toffolatti et al., 2020; Harper et al., 2022). To our knowledge, this is the first study where N369D and H272R mutant strains have been identified in Hungarian vineyards.

Table 2.

The list of identified amino acid substitutions in the sequenced genes. In the table the isolates are mentioned in which we found point mutation. Mutations with previously described effects were cited. In case of Erg27 protein the EC50 values are denoted for the fenhexamid intoxiacated media, in case of SdhB for fluopyram intoxicated media

ProteinAmino Acid changeIsolate nameEffectReferenceLocationEC50 [μg mL−1]
Erg27F412SALLMutant strains were shown to be fenhexamid-resistant, grew more slowly than the wild-type strain and displayed variations in the production of sclerotia and conidia with temperature and sensitivity to freezing.Grabke et al. (2013)not relevant
V309GB15-TU 243NAEger10.04
L327SB15-TU 243NAEger10.04
V367AB15-OR 4NAEger20.04
N369DB15-OR 193Several resistant strains harbored the mutation of the parental HydR3− mutant N369D, showing reduced pathogenicity and other fitness parameters without selective pressure.Fillinger et al. (2016)Eger20.04
N369DB15-OR 1Eger20.04
N369DB15-TU 153Eger10.03
N369DB20-T45Tokaj10.05
Y408NB15-OR180/1NAEger20.05
SdhBH272RB15-TU 260Strains confer moderate resistance levels against boscalid but they do not confer resistant to others SDHIs.Leroux et al. (2010)Eger10.81

In addition to the well-known mutations from other studies (reviewed by Fillinger et al., 2016), we have identified four amino acid substitutions in the Erg27 protein that may affect the fungicide susceptibility of the strains (see Table 2, last column where NAs are denoted). The V309G + L327S (valine to glycine at position 309 and leucine to serine at position 327) mutant isolate (B15-Tu 243) as well as the V367A (B15-Or 4, valine to alanine at position 367) gave a similar EC50 value for fenhexamid as the known resistant N369D mutant.

Discussion

The two selected wine regions have different pest management practices. It can be noted that in the case of Tokaj, the treatments against grey mold concentrated to the late May-late June period, which corresponds to the post-flowering stage in terms of plant phenology. In the case of the Eger, more treatments against B. cinerea were performed generally from post-flowering until the pre-harvest. The treatment at veraison limits the amount of B. cinerea infections that serve as a basis for later grey or noble rot in the grape maturation period.

In the Tokaj wine region, so-called Botrytis-friendly plant protection technology and viticultural practices are used in certain areas to grow Aszú grapes, while in the Eger wine region, grey mold is generally controlled. These two different pest management practices may have an impact on the prevalence of point mutations associated with fungicide resistance in B. cinerea strains, as the spraying practice in the Eger wine region may result in long-term exposure to chemicals.

The veraison period when most B. cinerea colonies on bunches or stems are sporulating and present as infection sites during ripening, and the weather conditions (warm, humid) during this period are suitable for grey mold. We found all the identical point mutations in samples from the Eger wine region which suggests that continuous fungicide exposure puts more chemical pressure on the fungus, resulting in increased survival of resistant mutants despite their reduced fitness, leading to their enrichment in the population (Laleve et al., 2014). We found more variants in Erg27 protein so this protein was more diverse in the B. cinerea samples. An interesting coincidence is that much larger amount of fenhexamid fungicide used in Hungarian agriculture than tebuconazole or fluopyram (Medináné Lázár, 2020). It is certainly worth investigating further whether there is a possible link between greater Erg27 diversity at the population level and the evolution of potential resistance due to higher pesticide use.

The significantly higher average fenhexamid EC50 values for Tokaj2 compared to Tokaj1 suggest that the pesticide pressure is likely higher in the former. The possible role of other factors like microclimate, age of the vineyard, or terroir in this difference can not be determined. However, it is notable, that while Tokaj2 is mostly producing dry white wines, Tokaj1 is producing sweet wines made from botrytized grapes. This suggests that the Tokaj1 area is less affected by the application of pesticides against B. cinerea, therefore the population of this fungus in the area is not as much evolved to overcome this chemical pressure. On the other hand, Tokaj 2 area is probably subjected to a more intensive pest management with fenhexamide against B. cinerea, explaining the differences between these two areas.

In contrast, for tebuconazole, EC50 values for Tokaj2 isolates were found to be significantly lower. This difference could be a local population characteristic, probably the result of the distance between the two areas and their different mesoclimatic conditions, as well as the different pesticide applications. While fenhexamid, can be assumed to be specific to grape grey mold, tebuconazole is also effective against powdery mildew. In the Tokaj2 area, which produces the raw material for dry wine, it is advisable to control B. cinerea specifically with fenhexamid during the period of veraison, as the maximum application quantity of the other active substance may have been used up in the previous treatments. To reinforce the role of pest management practices in the observed differences between the B. cinerea populations at Tokaj1 and Tokaj2, further field trials need to be designed.

For the combined agent, differences between sampling sites like those observed for fenhexamid were found. It is assumed that in this case too, the aszú grape growing aspect of the Tokaj1 area and the consequent reduced use of fungicides targeting B. cinerea result in a higher sensitivity in its population.

The EC50 value of the fenhexamid resistant isolate, the N369D variant was not significantly different from that of wild isolates when tested by the gradient plate method. Only one newly found point mutation showed a correlation with the resistance, the Y408N variant. However, all the isolates contain the F412S amino acid substitution which is the most frequently reported fenhexamid resistance marker. It is important to note that laboratory mutant isolates with F412S/I/V mutations grew slower than sensitive isolates and had variability in sclerotia and conidia production under different temperatures and on different media (Billard et al., 2012). In previous studies, there were statistically significant differences in growth rate for some fenhexamid-resistant isolates. They showed that overall, the resistant isolates had similar mycelial growth to the sensitive isolates however laboratory mutants of fenhexamid-resistant isolates of B. cinerea with F412S/I/V point mutations in erg27 had fitness loss, reduced growing rate in mycelial development compared with the sensitive isolates (Sofianos et al., 2023) In the context of these results, we hypothesize that the sensitivity to fenhexamid of the B. cinerea population in Northern Hungary is mainly determined by the presence of the F412S resistance mutation. The effect of the new point mutation will be confirmed by future studies.

It is also well-studied that, the predominant mutation of sdhB gene is the H272R, while in the French grape population, the predominant mutation is H272Y (Veloukas et al., 2011). This is a worldwide predominant mutation while mutations conferring high levels of resistance were found in lower frequencies. Such differences in mutation frequencies may account for differences in the fitness of the mutant strains, their survival and competitive ability in the field, the fungicide spray schedules, and the application doses. Reported results suggested that, despite a certain degree of variability, the two most found mutations (H272R and H272Y) were usually associated with moderate levels of resistance to boscalid. This finding agrees with that of Leroux et al. (2010) who also found that these two mutations were correlated with moderate levels of resistance to boscalid. We found H272R mutation in one isolate from Eger1 site, which shows higher resistance to tebuconazole and the combined pesticide (blue cross on Fig. 2). Others have also shown that this point mutation in the sdhB gene can cause fluopyram resistance (Harper et al., 2022). Further study of this isolate may shed light on what underlies the increased resistance.

The combined mutation of N369D and F412S causes elevated resistance to KRI-fungicides (Fillinger et al., 2008), however, in our study, isolates with a combined point mutation did not show higher resistance than those with only F412S. This also does not confirm that the specific mutations we found, which have not been previously described, directly cause this combined increased resistance. The EC50 values of N369D mutant is indicating a greatly reduced sensitivity to this KRI-fungicide in this variant. The mutant tyrosine to asparagine at position 408 (Y408N, B15-Or 180/1) showed higher EC50 values against fenhexamid than the resistant variants described in previous studies (Fillinger et al., 2016). These specific high EC50 values do not necessarily mean that a new resistance factor has been identified, as the combined presence of several point mutations in previously identified cases reveals clear fungicide resistance.

Figure 3 shows the structure of the Erg27 protein. The amino acid positions of the point mutations we have identified are indicated by an orange stripe. F412S, widely discussed in studies, is located in the transmembrane domain. Among the mutations we identified that have not been previously studied, Y408N is located in the same region. The active site catalyzing the formation of a hydroxyl group on position C3 of sterols is located near the transmembrane domain allowing the anchorage of the enzyme to the endoplasmic reticulum (Billard et al., 2011) which is reinforced by the fact that this isolate showed a high EC50 value for fenhexamide in a medium. Further investigation of this variant is required to understand the exact role of the identified point mutation.

Fig. 3.
Fig. 3.

The structure of ERG27 protein, where the active site and the transmembrane domain is denoted. Orange strips marks the identified amino acid substitutions' position

Citation: Acta Phytopathologica et Entomologica Hungarica 59, 1; 10.1556/038.2024.00205

Conclusion

In this study, we investigated the sensitivity of B. cinerea populations in the North Hungarian wine regions of Tokaj and Eger to different pesticide active substances used against grey rot. In all isolates, the F412S point mutation of the Erg27 protein causing fenhexamid resistance was identified, suggesting that B. cinerea strains infecting the vineyards of Northern Hungary have increased resistance. In addition, it was observed that the plant protection programme in the Eger wine region, which controls grey rot from flowering to veraison, causes increased resistance in the B. cinerea strains. To the authors' knowledge, this study is the first report to identify the N369D mutation of erg27 and H272R mutation of sdhB gene in Hungarian vineyards responsible for fenhexamid and boscalid resistance respectively. We have identified four previously unstudied point mutations in the erg27 gene, of which the Y408N amino acid substitution is located in the transmembrane domain of the protein and the mutant isolate shows increased fenhexamid resistance. Further investigation of this strain is strongly indicated.

Acknowledgements

This research was funded by Thematic Excellence Program (grant no. TKP2021-NKTA-16). This work was also supported by the Széchenyi 2020 programme, the European Regional Development Fund and the Hungarian Government (GINOP-2.3.2-15-2016-00061). We want to thank the owners of the Szepsy Kft. and Kaló Imre Pincészet Kft. for supporting the vineyard.

References

  • Alexoaei, A.P., Robu, R.G., Cojanu, V., Miron, D., and Holobiuc, A.M. (2022). Good practices in reforming the common agricultural policy to support the european green Deal–a perspective on the consumption of pesticides and fertilizers. Amfiteatru Economic, 24(60): 525545.

    • Search Google Scholar
    • Export Citation
  • Amiri, A., Heath, S.M., and Peres, N.A. (2014). Resistance to fluopyram, fluxapyroxad, and penthiopyrad in Botrytis cinerea from strawberry. Plant Disease, 98(4): 532539.

    • Search Google Scholar
    • Export Citation
  • Asadollahi, M., Fekete, É., Fekete, E., Karaffa, L., Irinyi, L., and Sándor, E. (2010). Cytochrome b diversity of Hungarian Botrytis cinerea strains. Acta Agraria Debreceniensis, (39): 1821.

    • Search Google Scholar
    • Export Citation
  • Billard, A., Fillinger, S., Leroux, P., Bach, J., Lanen, C., Lachaise, H., Beffa, R., and Debieu, D. (2011). Fenhexamid resistance in the Botrytis species complex, responsible for grey mould disease. Fungicides-Beneficial and Harmful Aspects, 4: 6178.

    • Search Google Scholar
    • Export Citation
  • Billard, A., Fillinger, S., Leroux, P., Lachaise, H., Beffa, R., and Debieu, D. (2012). Strong resistance to the fungicide fenhexamid entails a fitness cost in Botrytis cinerea, as shown by comparisons of isogenic strains. Pest Management Science, 68(5): 684691.

    • Search Google Scholar
    • Export Citation
  • Esterio, M., Ramos, C., Walker, A.S., Fillinger, S., Leroux, P., and Auger, J. (2011). Phenotypic and genetic characterization of Chilean isolates of Botrytis cinerea with different levels of sensitivity to fenhexamid. Phytopathologia Mediterranea, 50(3): 414420.

    • Search Google Scholar
    • Export Citation
  • Elad, Y., Pertot, I., Cotes Prado, A.M., and Stewart, A. (2016). Plant Hosts of Botrytis spp. In: Fillinger, S. and Elad, Y. (Eds.), Botrytis – the fungus, the pathogen and its management in agricultural systems. Springer, Cham, pp. 413486. https://doi.org/10.1007/978-3-319-23371-0_20.

    • Search Google Scholar
    • Export Citation
  • Esterio, M., Araneda, M.J., Román, A., Pizarro, L., Copier, C., and Auger, J. (2015). First report of boscalid resistant Botrytis cinerea isolates carrying the mutations H272R, H272Y, P225L, and P225H from table grape in Chile. Plant Disease, 99(6): 891–891.

    • Search Google Scholar
    • Export Citation
  • Fillinger, S. and Walker, A.S. (2016). Chemical control and resistance management of Botrytis diseases. In: Fillinger, S., and Elad, Y. (Eds.), Botrytis – the fungus, the pathogen and its management in agricultural systems. Springer, Cham, pp. 189216.

    • Search Google Scholar
    • Export Citation
  • Fillinger, S., Leroux, P., Auclair, C., Barreau, C., Al Hajj, C., and Debieu, D. (2008). Genetic analysis of fenhexamid-resistant field isolates of the phytopathogenic fungus Botrytis cinerea. Antimicrobial Agents and Chemotherapy, 52(11): 39333940.

    • Search Google Scholar
    • Export Citation
  • Fournier, E., Giraud, T., Albertini, C., and Brygoo, Y. (2005). Partition of the Botrytis cinerea complex in France using multiple gene genealogies. Mycologia, 97(6): 12511267.

    • Search Google Scholar
    • Export Citation
  • Grabke, A., Fernández-Ortuño, D., and Schnabel, G. (2013). Fenhexamid resistance in Botrytis cinerea from strawberry fields in the Carolinas is associated with four target gene mutations. Plant Disease, 97(2): 271276.

    • Search Google Scholar
    • Export Citation
  • Hahn, M. (2014). The rising threat of fungicide resistance in plant pathogenic fungi: Botrytis as a case study. Journal of Chemical Biology, 7: 133141.

    • Search Google Scholar
    • Export Citation
  • Harper, L.A., Paton, S., Hall, B., McKay, S., Oliver, R.P., and Lopez‐Ruiz, F.J. (2022). Fungicide resistance characterized across seven modes of action in Botrytis cinerea isolated from Australian vineyards. Pest Management Science, 78(4): 13261340.

    • Search Google Scholar
    • Export Citation
  • Hawkins, N.J., Cools, H.J., Sierotzki, H., Shaw, M.W., Knogge, W., Kelly, S.L., Kelly, D.E., and Fraaije, B.A. (2014). Paralog re-emergence: a novel, historically contingent mechanism in the evolution of antimicrobial resistance. Molecular Biology and Evolution, 31(7): 17931802.

    • Search Google Scholar
    • Export Citation
  • Hegyi-Kaló, J., Golen, R., and Váczy, K.Z. (2018). Botricidek hatékonyságának vizsgálata gradient plate módszerrel. In: A Magyar Mikrobiológiai Társaság 2018. évi Nagygyűlése és a XIII. Fermentációs Kollokvium. Magyar Mikrobiológiai Társaság (MMT), 17–19 October 2018. Eger, Hungary, p. 70.

    • Search Google Scholar
    • Export Citation
  • Lalève, A., Fillinger, S., and Walker, A.S. (2014). Fitness measurement reveals contrasting costs in homologous recombinant mutants of Botrytis cinerea resistant to succinate dehydrogenase inhibitors. Fungal Genetics and Biology, 67: 2436.

    • Search Google Scholar
    • Export Citation
  • Leroux, P., Gredt, M., Leroch, M., and Walker, A.S. (2010). Exploring mechanisms of resistance to respiratory inhibitors in field strains of Botrytis cinerea, the causal agent of gray mold. Applied and Environmental Microbiology, 76(19): 66156630.

    • Search Google Scholar
    • Export Citation
  • Lucas, J.A., Hawkins, N.J., and Fraaije, B.A. (2015). The evolution of fungicide resistance. Advances in Applied Microbiology, 90: 2992.

    • Search Google Scholar
    • Export Citation
  • Medináné Lázár, V. (2020). Növényvédő szerek értékesítése. XIX. 1. NAIK Agrárgazdasági Kutatóintézet, Budapest, Hungary. http://repo.aki.gov.hu/3555/.

    • Search Google Scholar
    • Export Citation
  • Moorman, G.W., Walker, A.S., and May, S. (2012). First report of fenhexamid-resistant Botrytis cinerea causing gray mold on Heurchera in a North American greenhouse. Plant Disease, 96(1): 147–147.

    • Search Google Scholar
    • Export Citation
  • Oksanen, J., Kindt, R., Legendre, P., O’Hara, B., Stevens, M.H.H., Oksanen, M.J., and Suggests, M.A.S.S. (2007). The vegan package. Community Ecology Package, 10(631–637): 719. http://vegan.r-forge.r-project.org/.

    • Search Google Scholar
    • Export Citation
  • Plesken, C., Weber, R.W., Rupp, S., Leroch, M., and Hahn, M. (2015). Botrytis pseudocinerea is a significant pathogen of several crop plants but susceptible to displacement by fungicide-resistant B. cinerea strains. Applied and Environmental Microbiology, 81(20): 70487056.

    • Search Google Scholar
    • Export Citation
  • Sofianos, G., Samaras, A., and Karaoglanidis, G. (2023). Multiple and multidrug resistance in Botrytis cinerea: molecular mechanisms of MLR/MDR strains in Greece and effects of co-existence of different resistance mechanisms on fungicide sensitivity. Frontiers in Plant Science, 14: 1273193, https://doi.org/10.3389/fpls.2023.1273193.

    • Search Google Scholar
    • Export Citation
  • Szojka, A., Asadollahi, M., Fekete, É., Fekete, E., Karaffa, L., and Sándor, E. (2011). Q-PCR analysis of the resistance of Hungarian Botrytis cinerea isolates toward azoxystrobin. Acta Agraria Debreceniensis, (43): 4144.

    • Search Google Scholar
    • Export Citation
  • Toffolatti, S.L., Russo, G., Bezza, D., Bianco, P.A., Massi, F., Marcianò, D., and Maddalena, G. (2020). Characterization of fungicide sensitivity profiles of Botrytis cinerea populations sampled in Lombardy (Northern Italy) and implications for resistance management. Pest Management Science, 76(6): 21982207.

    • Search Google Scholar
    • Export Citation
  • Váczy Kálmán, Z., Karaffa, L., Fekete, E., Kövics, G., Gál, L., and Karaffa, E.M. (2006). Distribution of transposons in Botrytis cinerea isolates collected from the wine regions of Eger and Tokaj, Hungary. In: Kövics, Gy.J., and Dávid, I. (Eds.), 4th International Plant Protection Symposium at Debrecen University. 18–19 October 2006. Debrecen, Hungary, pp. 9198.

    • Search Google Scholar
    • Export Citation
  • Veloukas, T., Leroch, M., Hahn, M., and Karaoglanidis, G.S. (2011). Detection and molecular characterization of boscalid-resistant Botrytis cinerea isolates from strawberry. Plant Disease, 95(10): 13021307.

    • Search Google Scholar
    • Export Citation
  • Waterhouse, A.M., Procter, J.B., Martin, D.M., Clamp, M., and Barton, G.J. (2009). Jalview Version 2—a multiple sequence alignment editor and analysis workbench. Bioinformatics, 25(9): 11891191.

    • Search Google Scholar
    • Export Citation
  • Weber, R.W.S. (2010). Vorkommen der Hyd R3 Fenhexamid-Resistenz bei Botrytis im norddeutschen Beerenobst-Anbau. Journal of Plant Diseases and Protection, 117: 177179.

    • Search Google Scholar
    • Export Citation
  • Alexoaei, A.P., Robu, R.G., Cojanu, V., Miron, D., and Holobiuc, A.M. (2022). Good practices in reforming the common agricultural policy to support the european green Deal–a perspective on the consumption of pesticides and fertilizers. Amfiteatru Economic, 24(60): 525545.

    • Search Google Scholar
    • Export Citation
  • Amiri, A., Heath, S.M., and Peres, N.A. (2014). Resistance to fluopyram, fluxapyroxad, and penthiopyrad in Botrytis cinerea from strawberry. Plant Disease, 98(4): 532539.

    • Search Google Scholar
    • Export Citation
  • Asadollahi, M., Fekete, É., Fekete, E., Karaffa, L., Irinyi, L., and Sándor, E. (2010). Cytochrome b diversity of Hungarian Botrytis cinerea strains. Acta Agraria Debreceniensis, (39): 1821.

    • Search Google Scholar
    • Export Citation
  • Billard, A., Fillinger, S., Leroux, P., Bach, J., Lanen, C., Lachaise, H., Beffa, R., and Debieu, D. (2011). Fenhexamid resistance in the Botrytis species complex, responsible for grey mould disease. Fungicides-Beneficial and Harmful Aspects, 4: 6178.

    • Search Google Scholar
    • Export Citation
  • Billard, A., Fillinger, S., Leroux, P., Lachaise, H., Beffa, R., and Debieu, D. (2012). Strong resistance to the fungicide fenhexamid entails a fitness cost in Botrytis cinerea, as shown by comparisons of isogenic strains. Pest Management Science, 68(5): 684691.

    • Search Google Scholar
    • Export Citation
  • Esterio, M., Ramos, C., Walker, A.S., Fillinger, S., Leroux, P., and Auger, J. (2011). Phenotypic and genetic characterization of Chilean isolates of Botrytis cinerea with different levels of sensitivity to fenhexamid. Phytopathologia Mediterranea, 50(3): 414420.

    • Search Google Scholar
    • Export Citation
  • Elad, Y., Pertot, I., Cotes Prado, A.M., and Stewart, A. (2016). Plant Hosts of Botrytis spp. In: Fillinger, S. and Elad, Y. (Eds.), Botrytis – the fungus, the pathogen and its management in agricultural systems. Springer, Cham, pp. 413486. https://doi.org/10.1007/978-3-319-23371-0_20.

    • Search Google Scholar
    • Export Citation
  • Esterio, M., Araneda, M.J., Román, A., Pizarro, L., Copier, C., and Auger, J. (2015). First report of boscalid resistant Botrytis cinerea isolates carrying the mutations H272R, H272Y, P225L, and P225H from table grape in Chile. Plant Disease, 99(6): 891–891.

    • Search Google Scholar
    • Export Citation
  • Fillinger, S. and Walker, A.S. (2016). Chemical control and resistance management of Botrytis diseases. In: Fillinger, S., and Elad, Y. (Eds.), Botrytis – the fungus, the pathogen and its management in agricultural systems. Springer, Cham, pp. 189216.

    • Search Google Scholar
    • Export Citation
  • Fillinger, S., Leroux, P., Auclair, C., Barreau, C., Al Hajj, C., and Debieu, D. (2008). Genetic analysis of fenhexamid-resistant field isolates of the phytopathogenic fungus Botrytis cinerea. Antimicrobial Agents and Chemotherapy, 52(11): 39333940.

    • Search Google Scholar
    • Export Citation
  • Fournier, E., Giraud, T., Albertini, C., and Brygoo, Y. (2005). Partition of the Botrytis cinerea complex in France using multiple gene genealogies. Mycologia, 97(6): 12511267.

    • Search Google Scholar
    • Export Citation
  • Grabke, A., Fernández-Ortuño, D., and Schnabel, G. (2013). Fenhexamid resistance in Botrytis cinerea from strawberry fields in the Carolinas is associated with four target gene mutations. Plant Disease, 97(2): 271276.

    • Search Google Scholar
    • Export Citation
  • Hahn, M. (2014). The rising threat of fungicide resistance in plant pathogenic fungi: Botrytis as a case study. Journal of Chemical Biology, 7: 133141.

    • Search Google Scholar
    • Export Citation
  • Harper, L.A., Paton, S., Hall, B., McKay, S., Oliver, R.P., and Lopez‐Ruiz, F.J. (2022). Fungicide resistance characterized across seven modes of action in Botrytis cinerea isolated from Australian vineyards. Pest Management Science, 78(4): 13261340.

    • Search Google Scholar
    • Export Citation
  • Hawkins, N.J., Cools, H.J., Sierotzki, H., Shaw, M.W., Knogge, W., Kelly, S.L., Kelly, D.E., and Fraaije, B.A. (2014). Paralog re-emergence: a novel, historically contingent mechanism in the evolution of antimicrobial resistance. Molecular Biology and Evolution, 31(7): 17931802.

    • Search Google Scholar
    • Export Citation
  • Hegyi-Kaló, J., Golen, R., and Váczy, K.Z. (2018). Botricidek hatékonyságának vizsgálata gradient plate módszerrel. In: A Magyar Mikrobiológiai Társaság 2018. évi Nagygyűlése és a XIII. Fermentációs Kollokvium. Magyar Mikrobiológiai Társaság (MMT), 17–19 October 2018. Eger, Hungary, p. 70.

    • Search Google Scholar
    • Export Citation
  • Lalève, A., Fillinger, S., and Walker, A.S. (2014). Fitness measurement reveals contrasting costs in homologous recombinant mutants of Botrytis cinerea resistant to succinate dehydrogenase inhibitors. Fungal Genetics and Biology, 67: 2436.

    • Search Google Scholar
    • Export Citation
  • Leroux, P., Gredt, M., Leroch, M., and Walker, A.S. (2010). Exploring mechanisms of resistance to respiratory inhibitors in field strains of Botrytis cinerea, the causal agent of gray mold. Applied and Environmental Microbiology, 76(19): 66156630.

    • Search Google Scholar
    • Export Citation
  • Lucas, J.A., Hawkins, N.J., and Fraaije, B.A. (2015). The evolution of fungicide resistance. Advances in Applied Microbiology, 90: 2992.

    • Search Google Scholar
    • Export Citation
  • Medináné Lázár, V. (2020). Növényvédő szerek értékesítése. XIX. 1. NAIK Agrárgazdasági Kutatóintézet, Budapest, Hungary. http://repo.aki.gov.hu/3555/.

    • Search Google Scholar
    • Export Citation
  • Moorman, G.W., Walker, A.S., and May, S. (2012). First report of fenhexamid-resistant Botrytis cinerea causing gray mold on Heurchera in a North American greenhouse. Plant Disease, 96(1): 147–147.

    • Search Google Scholar
    • Export Citation
  • Oksanen, J., Kindt, R., Legendre, P., O’Hara, B., Stevens, M.H.H., Oksanen, M.J., and Suggests, M.A.S.S. (2007). The vegan package. Community Ecology Package, 10(631–637): 719. http://vegan.r-forge.r-project.org/.

    • Search Google Scholar
    • Export Citation
  • Plesken, C., Weber, R.W., Rupp, S., Leroch, M., and Hahn, M. (2015). Botrytis pseudocinerea is a significant pathogen of several crop plants but susceptible to displacement by fungicide-resistant B. cinerea strains. Applied and Environmental Microbiology, 81(20): 70487056.

    • Search Google Scholar
    • Export Citation
  • Sofianos, G., Samaras, A., and Karaoglanidis, G. (2023). Multiple and multidrug resistance in Botrytis cinerea: molecular mechanisms of MLR/MDR strains in Greece and effects of co-existence of different resistance mechanisms on fungicide sensitivity. Frontiers in Plant Science, 14: 1273193, https://doi.org/10.3389/fpls.2023.1273193.

    • Search Google Scholar
    • Export Citation
  • Szojka, A., Asadollahi, M., Fekete, É., Fekete, E., Karaffa, L., and Sándor, E. (2011). Q-PCR analysis of the resistance of Hungarian Botrytis cinerea isolates toward azoxystrobin. Acta Agraria Debreceniensis, (43): 4144.

    • Search Google Scholar
    • Export Citation
  • Toffolatti, S.L., Russo, G., Bezza, D., Bianco, P.A., Massi, F., Marcianò, D., and Maddalena, G. (2020). Characterization of fungicide sensitivity profiles of Botrytis cinerea populations sampled in Lombardy (Northern Italy) and implications for resistance management. Pest Management Science, 76(6): 21982207.

    • Search Google Scholar
    • Export Citation
  • Váczy Kálmán, Z., Karaffa, L., Fekete, E., Kövics, G., Gál, L., and Karaffa, E.M. (2006). Distribution of transposons in Botrytis cinerea isolates collected from the wine regions of Eger and Tokaj, Hungary. In: Kövics, Gy.J., and Dávid, I. (Eds.), 4th International Plant Protection Symposium at Debrecen University. 18–19 October 2006. Debrecen, Hungary, pp. 9198.

    • Search Google Scholar
    • Export Citation
  • Veloukas, T., Leroch, M., Hahn, M., and Karaoglanidis, G.S. (2011). Detection and molecular characterization of boscalid-resistant Botrytis cinerea isolates from strawberry. Plant Disease, 95(10): 13021307.

    • Search Google Scholar
    • Export Citation
  • Waterhouse, A.M., Procter, J.B., Martin, D.M., Clamp, M., and Barton, G.J. (2009). Jalview Version 2—a multiple sequence alignment editor and analysis workbench. Bioinformatics, 25(9): 11891191.

    • Search Google Scholar
    • Export Citation
  • Weber, R.W.S. (2010). Vorkommen der Hyd R3 Fenhexamid-Resistenz bei Botrytis im norddeutschen Beerenobst-Anbau. Journal of Plant Diseases and Protection, 117: 177179.

    • Search Google Scholar
    • Export Citation
  • Collapse
  • Expand

Editor-in-Chief

Jenő KONTSCHÁN Centre for Agricultural Research, Hungary

Technical Editor

Ágnes TURÓCI Centre for Agricultural Research, Hungary

Section Editor

K SALÁNKI Centre for Agricultural Research, Hungary
 

Editorial Board

Z BOZSÓ Centre for Agricultural Research, Hungary
PE CHETVERIKOV Saint-Petersburg State University, Russia
JX CUI Henan Institute of Science and Technology, China
J FODOR Centre for Agricultural Research, Hungary
Z IMREI Centre for Agricultural Research, Hungary
BM KAYDAN Çukurova University, Turkey
L KISS University of Southern Queensland, Australia
V MARKÓ Hungarian University of Agriculture and Life Sciences, Hungary
MW NEGM Ibaraki University, Japan
L PALKOVICS Széchenyi István University, Hungary
M POGÁNY Centre for Agricultural Research, Hungary
D RÉDEI National Chung Hsing University, Taiwan
A TOLSTIKOV University of Tyumen, Russia
J VUTS Rothamsted Research, UK
GQ WANG Guangxi University, China

Acta Phytopathologica et Entomologica Hungarica
P.O. Box 102
H-1525 Budapest, Hungary
Phone: (36 1) 487 7534
Fax: (36 1) 487 7555
E-mail: acta@atk.hu

Indexing and Abstracting Services:

  • Biological Abstracts
  • BIOSIS Previews
  • CAB Abstracts
  • CABELLS Journalytics
  • Chemical Abstracts
  • Elsevier GEO Abstracts
  • Globals Health
  • Referativnyi Zhurnal
  • SCOPUS
  • Zoological Abstracts

 

 

2023  
Scopus  
CiteScore 1.1
CiteScore rank Q4 (Insect Science)
SNIP 0.279
Scimago  
SJR index 0.22
SJR Q rank Q4

Acta Phytopathologica et Entomologica Hungarica
Publication Model Hybrid
Submission Fee none
Article Processing Charge 900 EUR/article
Printed Color Illustrations 40 EUR (or 10 000 HUF) + VAT / piece
Regional discounts on country of the funding agency World Bank Lower-middle-income economies: 50%
World Bank Low-income economies: 100%
Further Discounts Editorial Board / Advisory Board members: 50%
Corresponding authors, affiliated to an EISZ member institution subscribing to the journal package of Akadémiai Kiadó: 100%
Subscription fee 2025 Online subsscription: 536 EUR / 590 USD
Print + online subscription: 626 EUR / 688 USD
Subscription Information Online subscribers are entitled access to all back issues published by Akadémiai Kiadó for each title for the duration of the subscription, as well as Online First content for the subscribed content.
Purchase per Title Individual articles are sold on the displayed price.

Acta Phytopathologica et Entomologica Hungarica
Language English
Size B5
Year of
Foundation
1966
Volumes
per Year
1
Issues
per Year
2
Founder Magyar Tudományos Akadémia  
Founder's
Address
H-1051 Budapest, Hungary, Széchenyi István tér 9.
Publisher Akadémiai Kiadó
Publisher's
Address
H-1117 Budapest, Hungary 1516 Budapest, PO Box 245.
Responsible
Publisher
Chief Executive Officer, Akadémiai Kiadó
ISSN 0238-1249 (Print)
ISSN 1588-2691 (Online)

Monthly Content Usage

Abstract Views Full Text Views PDF Downloads
Apr 2024 0 0 0
May 2024 0 0 0
Jun 2024 0 394 61
Jul 2024 0 81 17
Aug 2024 0 148 12
Sep 2024 0 128 29
Oct 2024 0 55 8