View More View Less
  • a Institute of Food Technology Novi Sad, University of Novi Sad, Bul. cara Lazara 1, 21000, Novi Sad, Serbia
  • | b Institute for Science Application in Agriculture, Bulevar despota Stefana 68B, 11000, Belgrade, Serbia
  • | c Institute of General and Physical Chemistry, University of Belgrade, Studentski Trg 12 - 16, 11000, Belgrade, Serbia
Open access

During previous years, regarding the shifts in climate conditions in temperate region, such as occurrence of high temperatures and prolonged drought, increased occurrence frequencies of Aspergillus flavus and aflatoxins in cereal grains were recorded. A reliable and accurate identification of the fungi is of great importance for evaluating the microbiological risks of contamination. The essential point of the present investigation was molecular characterisation and identification of A. flavus isolates originating from common wheat and spelt grains collected after harvest during the period of three years (2015–2017) in Northern Serbia. A holistic approach that included PCR amplification of two DNA genomic regions and PCR-RFLP assay followed by fragment length analysis, provided complete and comprehensive characterisation of A. flavus isolated from wheat grains. The presented results indicate that there was no difference among the tested Aspergillus isolates on the molecular–genetic level. All 38 strains were identified as A. flavus by sequencing of combined ITS region and β-tubulin gene fragments (acc. no.: MH582473 to MH582510). PCR-RFLP method in combination with a Lab-on-a-chip (LoaC) electrophoresis can be successfully used to rapidly identify A. flavus isolates.


During previous years, regarding the shifts in climate conditions in temperate region, such as occurrence of high temperatures and prolonged drought, increased occurrence frequencies of Aspergillus flavus and aflatoxins in cereal grains were recorded. A reliable and accurate identification of the fungi is of great importance for evaluating the microbiological risks of contamination. The essential point of the present investigation was molecular characterisation and identification of A. flavus isolates originating from common wheat and spelt grains collected after harvest during the period of three years (2015–2017) in Northern Serbia. A holistic approach that included PCR amplification of two DNA genomic regions and PCR-RFLP assay followed by fragment length analysis, provided complete and comprehensive characterisation of A. flavus isolated from wheat grains. The presented results indicate that there was no difference among the tested Aspergillus isolates on the molecular–genetic level. All 38 strains were identified as A. flavus by sequencing of combined ITS region and β-tubulin gene fragments (acc. no.: MH582473 to MH582510). PCR-RFLP method in combination with a Lab-on-a-chip (LoaC) electrophoresis can be successfully used to rapidly identify A. flavus isolates.

Wheat (Triticum aestivum L.) is a widely cultivated cereal in Serbia, with average production of approximately 4.3 t ha−1 in the period from 2015 to 2017 (Statistical Yearbook оf the Republic of Serbia, 2018). The main growing area for wheat production in Serbia is Vojvodina (Northern Province of Serbia), where average total production of wheat for the mentioned three-year period amounted to 1 526 425 t. In the recent years, an ancient wheat subspecies – spelt (Triticum aestivum ssp. spelta L. Thell) – has received growing production interest due to its superior nutritional and pro-health properties.

According to IARC classification, aflatoxins are in the first group as carcinogen compounds for humans and animals (IARC, 2002). Aspergillus flavus and associated toxins have occurred mainly on maize in temperate regions of Serbia when the weather conditions were dry and warm (Kos et al. , 2013; Janıć-Hajnal et al., 2017). However, a high incidence of A. flavus (45.8%) on wheat was recorded in 2012 as the result of high temperatures and extreme dry conditions during the summer (Levıć et al., 2013). Two A. flavus isolates collected from wheat in 2015 have shown the potential for aflatoxin B1 biosynthesis (Krulj et al., 2016). The recent study indicated the occurrence of A. flavus on spelt wheat in Serbia after harvest in 2016 (Krulj et al., 2017). Comparing the resistance of different wheat species, spelt wheat showed the strongest response to the artificial field infection with A. flavus and AFB1 biosynthesis (Krulj et al., 2018). Therefore, there is a potential for the occurrence of these fungi and their toxins in cereals such as wheat, which can pose health hazards to humans and animals.

Reliable and accurate identification of the fungi has a great importance for facilitating better assessment of contamination. Classical morphological-based methods for identification and distinguishing of the main toxigenic fungi occurring in foods and feeds present numerous confinements, such as labour-demanding aspects and significant specialised aptitude. Taking into account that morphological characters could be very volatile depending on the media and culture properties, misclassification of fungal species including Aspergillus spp. based on morphological attributes is not unusual (Wanu et al., 2001). Therefore, most identification methodologies are now based on DNA detection by using polymerase chain reaction (PCR) methods. The ITS region is considered to be a universal and primary molecular marker for identification of fungi (Whıte et al., 1990). However, each genus has its own specificity, and within the genus Aspergillus, calmodulin and β-tubulin genes are often used as secondary molecular markers (Rodrıuues et al., 2007). β-tubulin is a conserved gene, which provides a high level of interspecies variability, consequently it is often used for phylogenetic studies of Aspergillus (Peterson, 2008). Samson and Varua (2009) suggested at least two genomic sequences for the description and identification of the species using a multilocus approach.

PCR-restriction fragment length polymorphism (PCR-RFLP) is a simple, cost effective and quick tool for rapid detection of specific differences in DNA sequences of Aspergillus species (Somashekar et al., 2004).

The subject of the present research was a molecular characterisation of 38 A. flavus isolates from common wheat and spelt grains collected during the three-year period (2015– 2017) in Northern Serbia. Molecular approaches, based on PCR amplification of individual and combined sequences of ITS and β-tubulin, then CR-RFLP method followed by the fragment length analysis, provide complete and comprehensive characterisation of A. flavus isolated from wheat grains.

1 Materials and methods

1.1 Isolates

A. flavus cultures isolated from common wheat and spelt grain samples were collected during the three-year period (2015–2017) in Northern Serbia. Aspergillus cultures, purified by the single spore method and developed on potato dextrose agar (PDA), were afterwards grown on Czapek-Dox agar (CDA) medium at 25 °C for 7 days. On Aspergillus flavus and parasiticus agar (AFPA), specific medium for the identification of species from Flavi group, cultivations of the isolates were done at 30 °C for 3 days (Pıtt et al., 1983). A. flavus isolates were first identified by morphology (microscopic and macroscopic characteristics of the colonies) based on descriptions of Klıch (2002) and Samson and co-workers (2010).

1.2 Molecular identification of the isolates

Complete genomic DNA was extracted from mycelia using the DNA Isolation Kit (Agilent Technologies, Santa Clara, CA). The rDNA-ITS region was amplified applying the universal fungal primers ITS1 and ITS4 (Whıte et al., 1990). β-tubulin, a gene specific for the identification of Aspergillus species, is amplified by the pair of Bt2a/Bt2b primers, as well as by AflaFor/Bt2b. PCR was performed in a thermal cycler (Sure Cycles 8800; Agilent Technologies, Santa Clara, CA, USA) programmed for the appropriate cycling parameters (Nasrı et al., 2015; Baroševıć et al., 2016). Amplified PCR products were purified using silica-membrane-based columns of the QIA quick PCR Purification kit (Qiagen, Chadstone, Australia) as indicated by the manufacturer’s guidelines. After purification, DNA fragments were measured by the Agilent Bioanalyzer 2100 with LabChip DNA1000 (Agilent Technologies, CA, USA). Purified rDNAs, amplified by AflaFor/Bt2b, were sequenced and identified using BLAST programs at NCBI database.

1.3 Restriction enzyme digestion

The PCR products, amplified by the primers ITS1/ITS4, were digested with the HhaI and MwoI (HpyF10VI) enzymes (Thermo Scientific, USA). Digestion was performed by incubating a 10 μl aliquot of PCR product with 2 μl of 10 × Fast Digest buffer and 1 μl of Fast Digest enzyme, in a final reaction volume of 30 μl. Incubation was performed at 37 °C for 10 min. The digestion was heat-terminated at 80 °C for 20 min after incubation performed with MwoI, while the thermal inactivation to PCR products digested with the HhaI was not applied. The amplicons of β-tubulin gene (primers Bt2a/Bt2b) were digested with AlwI (BspPI) enzyme (Thermo Scientific, USA) for 4 h at 55 °C and heat-terminated at 80 °C for 20 min. The reaction mixture contained 10 μl of PCR amplicons, 2 μl of 10 × Buffer Tango, 1 μl of AlwI (BspPI) restriction enzyme, and 18 μl nuclease free-water. Visualisation of the restriction fragments was carried out by capillary electrophoresis at Agilent Bioanalyzer 2100 with Lab Chip DNA1000 (Agilent Technologies, CA, USA).

All above mentioned analyses performed on the tested isolates were carried out parallel to the A. flavus ATCC® 9643 reference strain in order to compare and confirm the identification.

2 Results and discussion

A. flavus isolates were first identified according to the macroscopic and microscopic morphological characteristics of their colonies (Klıch, 2002). AFPA (Aspergillus flavus and parasiticus agar) and CDA (Czapek-Dox agar) were used as specific media for A. flavus identification. AFPA (Aspergillus flavus and parasiticus agar) is a selective medium for the rapid identification of Aspergillus of section Flavi (Pıtt et al., 1983). The possibility of distinguishing Aspergillus species from the Flavi section is based on intense orange colony reverse when grown on AFPA. An intense orange colour was observed for all tested isolates (Figs 1A and 1B). None of the isolates showed a cream or brown reverse side on AFPA, which would correspond to A. oryzae and A. tamarii species, respectively (Rodrıuues et al., 2009). The conidia ornamentation and colour of the colonies on Czapek-Dox agar (CDA) were important features in identification. In this study, A. flavus colonies grown on Czapek- Dox agar were yellow-green (Figure 1C), while the colour of A. parasiticus colonies was dark green (Klıch, 2002). All yellow-green colonies had finely rough, round to elliptical conidia with thin walls, while dark green colonies showed extremely rough, more spherical conidia of thicker walls. These criteria have been applied as important principles for differentiation of A. flavus and A. parasiticus.

Fig. 1
Fig. 1

A. flavus on: AFPA (3 days, 30 °C): A: colony surface; B: colony reverse; C: CDA (7 days, 25 °C). AFPA: Aspergillus flavus and parasiticus agar; CDA: Czapek-Dox agar

Citation: Acta Alimentaria AAlim 49, 4; 10.1556/066.2020.49.4.3

Taxonomically, A. flavus conidia are mostly produced from heads bearing both metulae and phialides, while the most heads of A. parasiticus bear phialides alone (Klıch, 2002).

In general, morphological features are still widely used for identification of Aspergillus spp. This method is commonly used and is an essential tool for categorisation of fungal isolates in groups or sections, that allows further identification by other methods. Regardless of the morphological characteristics defined, this study has found variations within the A. flavus species related to the shade of colour, the structure of the colonies, and the possibility of forming sclerotia during the cultivation of isolates under the same conditions (Fig. 2).

Fig. 2
Fig. 2

Colony morphology of A. flavus isolates (PDA, 7 days, 25 °C) A: ATCC® 9643 reference strain, B: isolate Acc.No. MH582473, C: isolate Acc.No. MH582474; PDA: potato dextrose agar

Citation: Acta Alimentaria AAlim 49, 4; 10.1556/066.2020.49.4.3

Since the classical microbiological identification methods did not completely enable the precise and clearly defined classification of A. flavus, the implementation of molecular methods was necessary for the reliable and accurate identification of the tested isolates.

After DNA extraction from tested A. flavus isolates, PCR reactions were conducted with different primer pairs: ITS1/ITS4, AflaFor/Bt2b, and Bt2a/Bt2b. The products of the PCR reactions amplified by the pair of primers AflaFor/Bt2b were purified and sequenced. The nucleotide sequences have been submitted to the GenBank (accession numbers: MH582473 to MH582510). BLAST analysis showed that sequences from 38 A. flavus isolates shared 99% nucleotide identity with A. flavus species available from the GenBank database.

The fragment size obtained by PCR reaction with primers ITS1/ITS4 was 600 bp for all isolates, as well as the reference strain, which corresponds to the results of Dıba and co- workers (2014). The fragment size obtained by PCR reaction using the primer pair AflaFor/ Bt2b was 447 bp, while the fragment size amplified by the primers Bt2a/Bt2b was 565 bp (Table 1). Those results were in accordance with studies of Nasrı and co-workers (2015) and Baroševıć and co-workers (2016).

Table 1

Reference and obtained fragment sizes of PCR products amplified by the different primer pairs

PrimersGenSequences of primersReference fragment sizeObtained fragment size
ITS1 ITS4ITS region5’-TTCGTAGGTGAACCTGCGG-3’600 bpWHITE et al.,600
AflaForITS region/5’- GTGTCCTGTTATATCTGCCACAT -3’BAROšEVIĆ et al., 2016447
Bt2aβ-tubulin5′-GGTAACCAAATCGGTGCTGCTTTC-3′550 bpN ASRI et al.,565

The presented results indicated that there was no difference among the tested Aspergillus isolates on the molecular–genetic level. The separation of amplified PCR products of different A. flavus strains by Lab-on-a-chip electrophoresis was confirmed by sequencing. Therefore, the PCR method in combination with the Lab-on-a-chip electrophoresis can be successfully used for rapid differentiations of Aspergillus pecies.

Several studies have shown that the PCR-RFLP method might be valuable for the identification of numerous fungal species (Somashekar et al., 2004; Atouı & El Khoury, 2016). The digestion of PCR products performed by the use of restriction enzymes HhaI, MwoI, and AlwI, resulted in a number of fragments of characteristic sizes (Fig. 3). Gel image for AlwI is not shown. According to the fragment analysis, there are three restriction places for HhaI in the sequence of A. flavus that separated the PCR products into four fragments of 200 bp, 194 bp, 163 bp, and 112 bp. Also, the restriction enzyme MwoI was managed to cut the PCR product of A. flavus at three places resulting in four fragments of 318 bp, 115 bp, 81 bp, and 51 bp. Contrary to that, there was only one restriction place for AlwI in the sequence of A. flavus yielding two fragments of 287 bp and 245 bp. Nasrı and co-workers (2015) claimed that β-tubulin gene digestion, due to its own specificity, allowed a more discriminating RFLP assay for species distinction of clinically important Aspergillus spp.

Fig. 3
Fig. 3

Gel image of the electrophoretically separated PCR products digested with restriction enzymes: A: HhaI-RFLP of ITS-PCR products; B: MwoI-RFLP of ITS-PCR products; L: 25-1000 bp DNA ladder. Fragments labelled with 15 bp and 1500 bp are internal calibration markers

Citation: Acta Alimentaria AAlim 49, 4; 10.1556/066.2020.49.4.3

Digestion of the PCR products by the use of restriction enzymes produced same patterns of fragments among the isolates revealing genetic similarity. By comparing the number and the fragment size of the tested isolates with the profile of reference strain obtained by digestion with the same enzymes, it can be concluded that differences were not observed.

A. flavus and A. parasiticus have shown to possess high degree of genetic similarity and related genome size. Minor nucleotide variations in DNA sequence can be detected by PCR‐ RFLP analyses (Atouı & El Khoury, 2016). Regarding literature data, the use of restriction enzymes indicated the possibility of clear distinguishment of A. parasiticus and A. flavus. Analysis of RFLP products in agarose gel showed restriction profiles that clearly showed differences both in the number of fragments and in their size between the analysed samples of these two species (Somashekar et al., 2004; Atouı & El Khoury, 2016). Study of Mırhendı and co-workers (2007) showed that the size of PCR fragments amplified by ITS1/ ITS4 primers prior to digestion was 595 bp, which corresponds to the results obtained in this study (600 bp). On the other hand, the size of the fragments obtained after digestion with the HhaI enzyme according to the studies of these authors were 184 bp, 179 bp, 143 b,p and 89 bp. Differences in the size of fragments obtained using the same enzyme can be due to the application of different methods of electrophoresis. The same authors (Mırhendı et al., 2007) applied the agarose gel electrophoresis for separation of the PCR products, while in our tests separation was performed with Lab-on-a-chip electrophoresis. Similar differences were observed in the application of the MwoI when comparing the results of our tests with the results of Dıba and co-workers (2014), who tested the possibility of using this enzyme for identification and molecular characterisation of medically important Aspergillus species. Study of Nasrı and co-workers (2015) obtained the RFLP profile of AlwI with two fragments (296 bp and 254 bp) for used reference strains and investigated isolates. In this investigation, identification of A. flavus isolates based on RFLP assay of ITS region and β-tubulin gene was absolutely in accordance with sequencing pattern and results based on morphological criteria.

By comparing the phenotypic grouping of the isolates using colony colour on AFPA and CDA and conidia ornamentation with the molecular identification achieved by the β-tubulin and ITS sequence analysis and PCR‐RFLP analysis, we could observe that the two approaches are complementary to one another.

3 Conclusions

Molecular methods are gaining increased significance in species identification due to their high sensitivity, specificity, reproducibility, and performance speed. PCR-RFLP assay, as an effective, reliable, and quick method, gives the opportunity for faster identification and differentiation of the Aspergillus species than standard culturing methods and conventional sequencing of PCR products. In order to provide a more holistic approach, molecular characterisation of 38 Aspergillus isolates obtained from wheat and spelt grains over the three-year period in Northern Serbia was done. All analysed isolates were identified as A. flavus – the main agent responsible for aflatoxin contamination of cereals and other crops. So far, there is no report of aflatoxin contamination of wheat in Serbia. Nevertheless, the occurrence of toxigenic species such as A. flavus in the present study suggested that there is the potential risk of aflatoxin contamination of wheat grains used for the production of wheat- based food products.

This study was funded by the Ministry of Education, Science and Technological Development of the Republic of Serbia (451-03-68/2020-14/200222).

  • Atouı, A. & El Khoury, A. (2016): PCR-RFLP for Aspergillus species. Mycotoxigenic Fungi, 313–320.

  • Baroševıć, T., Bauı, F., Budakov, D., Kocsubඣ, S., Varua, J., & Stojšın, V. (2016): Molecular and morphological identification of Aspergillus species on corn seeds. Proceedings of the III International Congress, “Food Technology, Quality and Safety”; October 2527, 2016; Novi Sad; Serbia, pp. 365–371.

    • Search Google Scholar
    • Export Citation
  • Dıba, K., Mırhendı, H., Kordbacheh, P. & Rezaıe, S. (2014): Development of RFLP-PCR method for the identification of medically important Aspergillus species using single restriction enzyme MwoI. Braz. J. Microbiol., 45, 503507.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • IARC (2002): Monograph on the evaluation of carcinogenic risk to humans, vol. 82. World Health Organization, International Agency for Research on Cancer IARC, Lyon, France. p. 171.

    • Search Google Scholar
    • Export Citation
  • Janıć-Hajnal, E., Kos, J., Krulj, J., Krstovıć, S., Jajıć, I., & Nedeljkovıć, N. (2017): Aflatoxins contamination of maize in Serbia: The impact of weather conditions in 2015. Food Addit Contam, A, 34, 19992010.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Klıch, M.A. (2002): Identification of common Aspergillus species. Centraal bureau voor Schimmel cultures, Utrecht. 116 pages.

  • Kos, J., Mastılovıć, J., Hajnal, E.J. & Šarıć, B. (2013): Natural occurrence of aflatoxins in maize harvested in Serbia during 2009–2012. Food Control, 34, 31–34.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Krulj, J., Bočarov Stančıć, A., Krstovıć, S., Kojıć, J., Đısalov, J., & Bodroža-Solarov, M. (2016): Toxigenic potential of Aspergillus flavus cultures isolated from wheat grains. Proceedings of the III International Congress “Food Technology, Quality and Safety”; October, 27-29, 2016. Novi Sad, Serbia, 418–423.

    • Search Google Scholar
    • Export Citation
  • Krulj, J., Đısalov, J., Bodroža-Solarov, M., Bočarov Stančıć, A., Markov, S., & Kojıć, J. (2017): First report of Aspergillus flavus on organic spelt wheat in Serbia. Plant Dis., 101, 10451045.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Krulj, J., Đısalov, J., Bočarov Stančıć, A., Pezo, L., Kojıć, J., & Bodroža Solarov, M. (2018): Occurrence of aflatoxin B1 in Triticum species inoculated with Aspergillus flavus. World Mycotoxin J., 11, 247257.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Levıć, J., Gošıć-Dondo, S., Ivanovıć, D., Stankovıć, S., Krnjaja, V., & Stepanıć, A. (2013): An outbreak of Aspergillus species in response to environmental conditions in Serbia. Pestic. Phytotomed. Belgrade, 28, 167179.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Mırhendı, H., Dıba, K., Kordbacheh, P., Jalalızand, N. & Makımura, K. (2007): Identification of pathogenic Aspergillus species by a PCR-restriction enzyme method. J. Med. Microbiol., 56, 15681570.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Nasrı, T., Hedayatı, M.T., Abastabar, M., Pasqualotto, A.C., Armakı, M.T., & Nabılı, M. (2015): PCR-RFLP on β-tubulin gene for rapid identification of the most clinically important species of Aspergillus. J. Microbiol. Meth., 117, 144147.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Peterson, S.W. (2008): Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia, 100, 205226.

  • Pıtt, J.I., Hockınu, A.D. & Glenn, D.R. (1983): An improved medium for the detection of Aspergillus flavus and A. parasiticus. J. Appl. Bacteriol., 54, 109114.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rodrıuues, P., Soares, C., Kozakıeyıcz, Z., Paterson, R.R.M., Lıma, N. & Venâncıo, A. (2007): Identification and characterization of Aspergillus flavus and aflatoxins.-in: Mendez-Vılas, A. (Ed.) Communicating current research and educational topics and trends in applied microbiology. Bajadoz, Formatex. pp. 527534.

    • Search Google Scholar
    • Export Citation
  • Rodrıuues, P., Venâncıo, A., Kozakıeyıcz, Z. & Lıma, N. (2009): A polyphasic approach to the identification of aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi isolated from Portuguese almonds. Int. J. Food Microbiol., 129(2), 187193.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Samson, R.A. & Varua, J. (2009): What is a species in Aspergillus? Med. Mycol., 47, S13–S20.

  • Samson, R.A., Houbraken, J., Thrane, U., Frısvad, J.C. & Andersen, B. (2010): Food and indoor fungi. CBS KNAW Biodiversity Center, Utrecht. 390 pages.

    • Search Google Scholar
    • Export Citation
  • Somashekar, D., Ratı, E.R. & Chandrashekar, A. (2004): PCR-restriction fragment length analysis of aflR gene for differentiation and detection of Aspergillus flavus and Aspergillus parasiticus in maize. Int. J. Food Microbiol., 93, 101107.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Statıstıcal Yearbook of the Republıc of Serbıa (2018): Chapter Agriculture. Statistical Office of the Republic of Serbia.

  • Wanu, L., Yokoyama, K., Takahası, H., Kase, N., Hanya, Y., & Nıshımura, K. (2001): Identification of species in Aspergillus section Flavi based on sequencing of the mitochondrial cytochrome b gene. Int. J. Food Microbiol., 71, 7586.

    • Search Google Scholar
    • Export Citation
  • Whıte, T.J., Burns, T., Lee, S. & Taylor, J.W. (1990): Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics.-in: Innıs, M.A., Gelfald, D.H., Snınsky, J.J & Whıte, T.J. (Eds) PCR protocol: A guide to methods and applications. Academic Press, New York, USA, pp. 315322.

    • Search Google Scholar
    • Export Citation
  • Atouı, A. & El Khoury, A. (2016): PCR-RFLP for Aspergillus species. Mycotoxigenic Fungi, 313–320.

  • Baroševıć, T., Bauı, F., Budakov, D., Kocsubඣ, S., Varua, J., & Stojšın, V. (2016): Molecular and morphological identification of Aspergillus species on corn seeds. Proceedings of the III International Congress, “Food Technology, Quality and Safety”; October 2527, 2016; Novi Sad; Serbia, pp. 365–371.

    • Search Google Scholar
    • Export Citation
  • Dıba, K., Mırhendı, H., Kordbacheh, P. & Rezaıe, S. (2014): Development of RFLP-PCR method for the identification of medically important Aspergillus species using single restriction enzyme MwoI. Braz. J. Microbiol., 45, 503507.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • IARC (2002): Monograph on the evaluation of carcinogenic risk to humans, vol. 82. World Health Organization, International Agency for Research on Cancer IARC, Lyon, France. p. 171.

    • Search Google Scholar
    • Export Citation
  • Janıć-Hajnal, E., Kos, J., Krulj, J., Krstovıć, S., Jajıć, I., & Nedeljkovıć, N. (2017): Aflatoxins contamination of maize in Serbia: The impact of weather conditions in 2015. Food Addit Contam, A, 34, 19992010.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Klıch, M.A. (2002): Identification of common Aspergillus species. Centraal bureau voor Schimmel cultures, Utrecht. 116 pages.

  • Kos, J., Mastılovıć, J., Hajnal, E.J. & Šarıć, B. (2013): Natural occurrence of aflatoxins in maize harvested in Serbia during 2009–2012. Food Control, 34, 31–34.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Krulj, J., Bočarov Stančıć, A., Krstovıć, S., Kojıć, J., Đısalov, J., & Bodroža-Solarov, M. (2016): Toxigenic potential of Aspergillus flavus cultures isolated from wheat grains. Proceedings of the III International Congress “Food Technology, Quality and Safety”; October, 27-29, 2016. Novi Sad, Serbia, 418–423.

    • Search Google Scholar
    • Export Citation
  • Krulj, J., Đısalov, J., Bodroža-Solarov, M., Bočarov Stančıć, A., Markov, S., & Kojıć, J. (2017): First report of Aspergillus flavus on organic spelt wheat in Serbia. Plant Dis., 101, 10451045.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Krulj, J., Đısalov, J., Bočarov Stančıć, A., Pezo, L., Kojıć, J., & Bodroža Solarov, M. (2018): Occurrence of aflatoxin B1 in Triticum species inoculated with Aspergillus flavus. World Mycotoxin J., 11, 247257.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Levıć, J., Gošıć-Dondo, S., Ivanovıć, D., Stankovıć, S., Krnjaja, V., & Stepanıć, A. (2013): An outbreak of Aspergillus species in response to environmental conditions in Serbia. Pestic. Phytotomed. Belgrade, 28, 167179.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Mırhendı, H., Dıba, K., Kordbacheh, P., Jalalızand, N. & Makımura, K. (2007): Identification of pathogenic Aspergillus species by a PCR-restriction enzyme method. J. Med. Microbiol., 56, 15681570.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Nasrı, T., Hedayatı, M.T., Abastabar, M., Pasqualotto, A.C., Armakı, M.T., & Nabılı, M. (2015): PCR-RFLP on β-tubulin gene for rapid identification of the most clinically important species of Aspergillus. J. Microbiol. Meth., 117, 144147.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Peterson, S.W. (2008): Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia, 100, 205226.

  • Pıtt, J.I., Hockınu, A.D. & Glenn, D.R. (1983): An improved medium for the detection of Aspergillus flavus and A. parasiticus. J. Appl. Bacteriol., 54, 109114.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Rodrıuues, P., Soares, C., Kozakıeyıcz, Z., Paterson, R.R.M., Lıma, N. & Venâncıo, A. (2007): Identification and characterization of Aspergillus flavus and aflatoxins.-in: Mendez-Vılas, A. (Ed.) Communicating current research and educational topics and trends in applied microbiology. Bajadoz, Formatex. pp. 527534.

    • Search Google Scholar
    • Export Citation
  • Rodrıuues, P., Venâncıo, A., Kozakıeyıcz, Z. & Lıma, N. (2009): A polyphasic approach to the identification of aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi isolated from Portuguese almonds. Int. J. Food Microbiol., 129(2), 187193.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Samson, R.A. & Varua, J. (2009): What is a species in Aspergillus? Med. Mycol., 47, S13–S20.

  • Samson, R.A., Houbraken, J., Thrane, U., Frısvad, J.C. & Andersen, B. (2010): Food and indoor fungi. CBS KNAW Biodiversity Center, Utrecht. 390 pages.

    • Search Google Scholar
    • Export Citation
  • Somashekar, D., Ratı, E.R. & Chandrashekar, A. (2004): PCR-restriction fragment length analysis of aflR gene for differentiation and detection of Aspergillus flavus and Aspergillus parasiticus in maize. Int. J. Food Microbiol., 93, 101107.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • Statıstıcal Yearbook of the Republıc of Serbıa (2018): Chapter Agriculture. Statistical Office of the Republic of Serbia.

  • Wanu, L., Yokoyama, K., Takahası, H., Kase, N., Hanya, Y., & Nıshımura, K. (2001): Identification of species in Aspergillus section Flavi based on sequencing of the mitochondrial cytochrome b gene. Int. J. Food Microbiol., 71, 7586.

    • Search Google Scholar
    • Export Citation
  • Whıte, T.J., Burns, T., Lee, S. & Taylor, J.W. (1990): Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics.-in: Innıs, M.A., Gelfald, D.H., Snınsky, J.J & Whıte, T.J. (Eds) PCR protocol: A guide to methods and applications. Academic Press, New York, USA, pp. 315322.

    • Search Google Scholar
    • Export Citation


The author instruction is available in PDF.
Please, download the file from HERE.

Senior editors

Editor(s)-in-Chief: András Salgó

Co-ordinating Editor(s) Marianna Tóth-Markus

Co-editor(s): A. Halász

       Editorial Board

  • L. Abrankó (Szent István University, Gödöllő, Hungary)
  • D. Bánáti (University of Szeged, Szeged, Hungary)
  • J. Baranyi (Institute of Food Research, Norwich, UK)
  • I. Bata-Vidács (Agro-Environmental Research Institute, National Agricultural Research and Innovation Centre, Budapest, Hungary)
  • J. Beczner (Food Science Research Institute, National Agricultural Research and Innovation Centre, Budapest, Hungary)
  • F. Békés (FBFD PTY LTD, Sydney, NSW Australia)
  • Gy. Biró (National Institute for Food and Nutrition Science, Budapest, Hungary)
  • A. Blázovics (Semmelweis University, Budapest, Hungary)
  • F. Capozzi (University of Bologna, Bologna, Italy)
  • M. Carcea (Research Centre for Food and Nutrition, Council for Agricultural Research and Economics Rome, Italy)
  • Zs. Cserhalmi (Food Science Research Institute, National Agricultural Research and Innovation Centre, Budapest, Hungary)
  • M. Dalla Rosa (University of Bologna, Bologna, Italy)
  • I. Dalmadi (Szent István University, Budapest, Hungary)
  • K. Demnerova (University of Chemistry and Technology, Prague, Czech Republic)
  • M. Dobozi King (Texas A&M University, Texas, USA)
  • Muying Du (Southwest University in Chongqing, Chongqing, China)
  • S. N. El (Ege University, Izmir, Turkey)
  • S. B. Engelsen (University of Copenhagen, Copenhagen, Denmark)
  • E. Gelencsér (Food Science Research Institute, National Agricultural Research and Innovation Centre, Budapest, Hungary)
  • V. M. Gómez-López (Universidad Católica San Antonio de Murcia, Murcia, Spain)
  • J. Hardi (University of Osijek, Osijek, Croatia)
  • K. Héberger (Research Centre for Natural Sciences, ELKH, Budapest, Hungary)
  • N. Ilić (University of Novi Sad, Novi Sad, Serbia)
  • D. Knorr (Technische Universität Berlin, Berlin, Germany)
  • H. Köksel (Hacettepe University, Ankara, Turkey)
  • K. Liburdi (Tuscia University, Viterbo, Italy)
  • M. Lindhauer (Max Rubner Institute, Detmold, Germany)
  • M.-T. Liong (Universiti Sains Malaysia, Penang, Malaysia)
  • M. Manley (Stellenbosch University, Stellenbosch, South Africa)
  • M. Mézes (Szent István University, Gödöllő, Hungary)
  • Á. Németh (Budapest University of Technology and Economics, Budapest, Hungary)
  • P. Ng (Michigan State University,  Michigan, USA)
  • Q. D. Nguyen (Szent István University, Budapest, Hungary)
  • L. Nyström (ETH Zürich, Switzerland)
  • L. Perez (University of Cordoba, Cordoba, Spain)
  • V. Piironen (University of Helsinki, Finland)
  • A. Pino (University of Catania, Catania, Italy)
  • M. Rychtera (University of Chemistry and Technology, Prague, Czech Republic)
  • K. Scherf (Technical University, Munich, Germany)
  • R. Schönlechner (University of Natural Resources and Life Sciences, Vienna, Austria)
  • A. Sharma (Department of Atomic Energy, Delhi, India)
  • A. Szarka (Budapest University of Technology and Economics, Budapest, Hungary)
  • M. Szeitzné Szabó (National Food Chain Safety Office, Budapest, Hungary)
  • S. Tömösközi (Budapest University of Technology and Economics, Budapest, Hungary)
  • L. Varga (University of West Hungary, Mosonmagyaróvár, Hungary)
  • R. Venskutonis (Kaunas University of Technology, Kaunas, Lithuania)
  • B. Wróblewska (Institute of Animal Reproduction and Food Research, Polish Academy of Sciences Olsztyn, Poland)


Acta Alimentaria

Indexing and Abstracting Services:

  • Biological Abstracts
  • BIOSIS Previews
  • CAB Abstracts
  • Chemical Abstracts
  • Current Contents: Agriculture, Biology and Environmental Sciences
  • Elsevier Science Navigator
  • Essential Science Indicators
  • Global Health
  • Index Veterinarius
  • Science Citation Index
  • Science Citation Index Expanded (SciSearch)
  • The ISI Alerting Services


Total Cites
Impact Factor
Rank by
Nutrition & Dietetics 79/89 (Q4)
Impact Factor
Food Science & Technology 130/144 (Q4)
Impact Factor
Journal Self Cites
5 Year
Impact Factor
Citation Indicator
Rank by Journal
Nutrition & Dietetics 88/103 (Q4)
Citation Indicator
Food Science & Technology 142/160 (Q4)
Journal Rank
Food Science Q3
Quartile Score
Scite Score
Food Science 216/310 (Q3)
Scite Score Rank
Days from
to acceptance
Days from
to publication
Total Cites
Impact Factor 0,458
Impact Factor
Journal Self Cites
5 Year
Impact Factor
Article Influence
% Articles
Citable Items
Journal Rank
Scite Score
Scite Score Rank
Food Science 215/299 (Q3)


Acta Alimentaria
Publication Model Hybrid
Submission Fee none
Article Processing Charge 1100 EUR/article
Printed Color Illustrations 40 EUR (or 10 000 HUF) + VAT / piece
Regional discounts on country of the funding agency World Bank Lower-middle-income economies: 50%
World Bank Low-income economies: 100%
Further Discounts Editorial Board / Advisory Board members: 50%
Corresponding authors, affiliated to an EISZ member institution subscribing to the journal package of Akadémiai Kiadó: 100%
Subscription fee 2021 Online subsscription: 736 EUR / 920 USD
Print + online subscription: 852 EUR / 1064 USD
Subscription fee 2022 Online subsscription: 754 EUR / 944 USD
Print + online subscription: 872 EUR / 1090 USD
Subscription Information Online subscribers are entitled access to all back issues published by Akadémiai Kiadó for each title for the duration of the subscription, as well as Online First content for the subscribed content.
Purchase per Title Individual articles are sold on the displayed price.

Acta Alimentaria
Language English
Size B5
Year of
2021 Volume 50
per Year
per Year
Founder Magyar Tudományos Akadémia    
H-1051 Budapest, Hungary, Széchenyi István tér 9.
Publisher Akadémiai Kiadó
H-1117 Budapest, Hungary 1516 Budapest, PO Box 245.
Chief Executive Officer, Akadémiai Kiadó
ISSN 0139-3006 (Print)
ISSN 1588-2535 (Online)


Monthly Content Usage

Abstract Views Full Text Views PDF Downloads
Jun 2021 0 34 32
Jul 2021 0 51 51
Aug 2021 0 59 45
Sep 2021 0 69 76
Oct 2021 0 43 76
Nov 2021 0 71 79
Dec 2021 0 14 14