Authors:
A. ArefinejadStudent Research Committee, Birjand University of Medical Sciences, Birjand, Iran

Search for other papers by A. Arefinejad in
Current site
Google Scholar
PubMed
Close
,
M. KhodadadiDepartment of Environmental Health Engineering, School of Health, Medical Toxicology and Drug Abuse Research Center (MTDRC), Birjand University of Medical Sciences, Birjand, Iran

Search for other papers by M. Khodadadi in
Current site
Google Scholar
PubMed
Close
https://orcid.org/0000-0002-6655-8125
,
T. ZeinaliDepartment of Public Health, School of Health, Social Determinants of Health Research Center, Birjand University of Medical Sciences, Birjand, Iran

Search for other papers by T. Zeinali in
Current site
Google Scholar
PubMed
Close
, and
M. YousefiInfectious Diseases Research Center, Birjand University of Medical Sciences, Birjand, Iran

Search for other papers by M. Yousefi in
Current site
Google Scholar
PubMed
Close
View More View Less
Open access

Abstract

The aims of the present study were to detect Escherichia coli in chicken distributed in Birjand, to investigate the prevalence of ESBL and AmpC beta-lactamases producers among them, and to identify their antibiotic resistance patterns. The study was conducted on 150 chicken samples, and the antimicrobial susceptibility patterns were determined by the Kirby–Bauer disk diffusion method. Phenotypic identification of ESBL and AmpC was performed by the combined disk test (CDT). The specific genes of ESBL and AmpC beta-lactamases were detected using two multiplex PCR (m-PCR) assays. According to our results, 116 out of 150 chicken samples were contaminated with E. coli. Moreover, the highest resistance of E. coli isolates was observed to trimethoprim/sulfamethoxazole (46%), ampicillin (40%), and amoxicillin (29.33%). In the molecular confirmation step, among 17 (11.33%) beta-lactamase producers, five samples contained the blaCTX-M14 gene (3.33%), two samples contained blaDHA (1.33%) and blaCTX-M3 gene (1.33%), and just one sample carried blaCMY-2 gene (0.66%). The blaSHV and blaTEM genes were not detected in any strains isolated from the chicken samples. This study showed the contamination of chicken with antibiotic-resistant E. coli. Therefore, it is recommended that veterinarians be more precautious in prescribing antibiotics.

Abstract

The aims of the present study were to detect Escherichia coli in chicken distributed in Birjand, to investigate the prevalence of ESBL and AmpC beta-lactamases producers among them, and to identify their antibiotic resistance patterns. The study was conducted on 150 chicken samples, and the antimicrobial susceptibility patterns were determined by the Kirby–Bauer disk diffusion method. Phenotypic identification of ESBL and AmpC was performed by the combined disk test (CDT). The specific genes of ESBL and AmpC beta-lactamases were detected using two multiplex PCR (m-PCR) assays. According to our results, 116 out of 150 chicken samples were contaminated with E. coli. Moreover, the highest resistance of E. coli isolates was observed to trimethoprim/sulfamethoxazole (46%), ampicillin (40%), and amoxicillin (29.33%). In the molecular confirmation step, among 17 (11.33%) beta-lactamase producers, five samples contained the blaCTX-M14 gene (3.33%), two samples contained blaDHA (1.33%) and blaCTX-M3 gene (1.33%), and just one sample carried blaCMY-2 gene (0.66%). The blaSHV and blaTEM genes were not detected in any strains isolated from the chicken samples. This study showed the contamination of chicken with antibiotic-resistant E. coli. Therefore, it is recommended that veterinarians be more precautious in prescribing antibiotics.

1 Introduction

Escherichia coli as member of the normal intestinal flora of humans, poultry, and other animals has great medical importance due to pathogenic E. coli strains that cause intestinal diseases and food infection in humans. E. coli can cause various infections, including meningitis, endocarditis, urinary tract infections, sepsis, diarrhea, and cellulitis (Akond et al., 2009).

Nowadays, the use of antibiotics for treatment of bacterial infection as well as growth promotion has been remarkably increased in the broiler industry. This fact may lead to increased bacterial antibiotic resistance (Ojer-Usoz et al., 2017). Antibiotic treatment plays the most critical role in the global emergence and spread of antibiotic-resistant microorganisms. These strains may transfer their elements of antibiotic resistance to other human pathogens. E. coli strains are highly capable of acquiring and transferring resistance genes (Ryu et al., 2012a).

Beta-lactamase enzymes are the leading cause of antibiotic resistance in Gram-negative bacteria (Barilli et al., 2019). Nowadays, more novel beta-lactamases are emerging, including Extended-Spectrum Beta-Lactamase (ESBL) and AmpC beta-lactamases. ESBLs cause resistance to beta-lactam antibiotics by degrading the beta-lactam ring through hydrolysis (Ryu et al., 2012b). ESBLs are among the most critical determinants of resistance against oximino-cephalosporines in Enterobacteriaceae (Barilli et al., 2019), while AmpC beta-lactamases can lead to resistance against aminopenicillins, cephalosporins, oximino-cephalosporins, cephamycin, and monobactams. Cloxacillin and aminophenyl boric acid can inhibit AmpC beta-lactamases. Up to now, no standard method has been identified for detecting and identifying the bacterial strains producing AmpC beta-lactamases (Peter-Getzlaff et al., 2011).

ESBL genes have been reported and documented in food animals, especially poultry. Recent studies on broiler chicken in the UK have reported the blaCTX-M1 as the most common ESBL gene, followed by blaTEM and blaSHV as the most extensively reported genes in Europe (Barilli et al., 2019). High similarities have been reported in the ESBL-producing E. coli strains and related genes between chicken and humans, highlighting the possibility of chicken as the potential source of ESBL-producing E. coli in humans (Biasino et al., 2018).

Isolation of antibiotic-resistant bacteria and evaluation of their local distribution is of great importance. The present study was the first attempt in Birjand, East of Iran, to detect both phenotypically and genotypically beta-lactamase producer E. coli in chicken. Considering the importance of this problem in human health and the high global prevalence of this specific antibiotic resistance type, the present study aimed to detect and isolate E. coli in chicken distributed in Birjand, to investigate the prevalence of E. coli strains producing ESBL and AmpC beta-lactamases, and to identify their antibiotic resistance profiles.

2 Materials and method

2.1 Sampling

In the present study, 150 chicken samples were purchased from markets of Birjand from October to November 2020. The meat collected included 50 samples of whole chicken, 50 samples of sliced non-spicy chicken, and 50 samples of sliced, spicy chicken. The samples were put in a container filled with ice and were immediately transferred to the laboratory.

2.2 Isolation and identification of E. coli

Three grams from each chicken sample was homogenised with 27 ml of peptone water (Merck KGaA, Darmstadt, Germany) and enriched at 37 °C for 24 h (Feng et al., 2020; Saei et al., 2022). Afterward, 100 μL of the enriched sample was cultured on EMB agar (Merck KGaA, Darmstadt, Germany) at 37 °C for 24 h. Dark colonies with a green metallic luster were considered as suspected E. coli isolates, which were further identified based on Gram staining and the results of biochemical tests like SIM (sulphide, indole, motility), triple sugar iron, citrate, and Methyl-Red Voges-Proskauer (MR-VP) (Feng et al., 2020; Saei et al., 2022).

2.3 Antibiotic susceptibility testing

The antibiotic susceptibility of the isolates was performed using the Kirby-Bauer disk diffusion method according to Clinical and Laboratory Standards Institute guidelines (CLSI, 2018). The antimicrobial agents (Rosco, Taastrup, Denmark) used in this study included ampicillin (10 µg), cefepime (30 µg), trimethoprim/sulfamethoxazole (1.25 µg + 23.75 µg), amoxicillin/clavulanic acid (20 µg + 10 µg), gentamycin (10 µg), azithromycin (15 µg), imipenem (10 µg), meropenem (10 µg), and ceftazidime (30 µg). For quality control of the antibiotic susceptibility test, E. coli ATCC 25922 was used (Su et al., 2016). Isolates that had resistance to more than three antimicrobial agents were considered multidrug resistant (MDR) (Motallebi et al., 2011).

2.4 Screening and identification of ESBL and AmpC producing E. coli isolates

ESBL production was detected utilising the combined disk test (CDT) method based on CLSI recommendations. Briefly, susceptibility to ceftazidime (30 µg), ceftazidime/clavulanic acid (30 µg + 10 µg), cefotaxime (30 µg), and cefotaxime/clavulanic acid (30 µg + 10 µg) was determined on Muller-Hinton agar (Merck KGaA, Darmstadt, Germany). ESBL-producing strains were recognised by an at least 5-mm increase in zone diameter around cefotaxime/clavulanate and ceftazidime/clavulanate disks compared with disks without clavulanic acid. E. coli ATCC25922 and Klebsiella pneumonia ATCC700603 were used as control strains. Moreover, the isolates with a zone of inhibition lower than 19 mm around the cefoxitin (30 µg) disk were considered as suspected carriers of the AmpC gene (Peter-Getzlaff et al., 2011; Ogbolu et al., 2013).

2.5 DNA extraction from E. coli isolates

The E. coli isolates were inoculated into the microtubes containing 150–200 μL of sterile deionised distilled water and heated at 100 °C for 10 min. Afterward, the microtubes were centrifuged at 10,000 r.p.m. for 10 min, and the DNA-containing supernatant was transferred to a new microtube (Hosseini et al., 2013; Jamshidi et al., 2015).

2.6 Detection of ESBL or AmpC genes

The primers used for the amplification of the beta-lactamase genes are listed in Table 1. The specific genes of ESBL and AmpC were amplified using two multiplex polymerase chain reaction (m-PCR) tests. The first m-PCR test was used to detect the blaCTX-M3, blaCTX-M14, and blaSHV genes, and the second m-PCR for the blaCMY-2, blaDHA, and blaTEM genes.

Table 1.

Target genes and their primers used in this study (Su et al., 2016)

GenesPrimerSequences of primers (5–3)Size (Bp)
blaCTX-M3FAATCA CTGCG CCAGT TCACG CT479
RGAACG TTTCG TCTCC CAGCT GT
blaCTX-M14FTACCG CAGAT AATAC GCAGG TG355
RCAGCG TAGGT TCAGT GCGAT CC
blaSHVFATGCGTTATATTCGCCTGTGTAT868
RTTAGCGTTGCCAGTGCTCGATCAG
blaTEMFATGAGTATTCAACATTTCCG868
RCTGACAGTTACCAATGCTTA
blaDHAFAACTT TCACA GGTGT GCTGG GT405
RCGTAC GCATA CTGGC TTTGC
blaCMY-2FCTGAC AGCCT CTTTC TCCAC A1,100
RCTACG TAGCT GCCAA ATCCA C

The first m-PCR reaction was in the total volume of 20 μL (10 μL of 2X Hot Star Taq PCR Master Mix (Amplicon, Odense, Denmark), 2 μL of the DNA template, primers (10 pmol μL−1; 0.5 μL of blaCTX-M3, 1 μL of blaCTX-M14, and 0.6 μL of blaSHV primers), and 3.8 μL of ddH2O. The second m-PCR mixture was also included 20 μL (10 μL of 2X Hot Star Taq Master Mix, 2 μL of the DNA template, primers (10 pmol μL−1; 0.5 μL of each blaDHA, blaCMY-2, and blaTEM primers), and 5 μL of ddH2O). The positive control included K. pneumonia ATCC700603 and E. coli ATCC25922.

PCR schedule was as follows: 1) Initial denaturation at 95 °C for 45 s, 2) 30 cycles including denaturation at 95 °C for 45 s, annealing at 63 °C for 45 s, and extension at 72 °C for 45 s, and 3) a final extension at 72 °C for 10 min. Finally, the amplified products were electrophoresed on 1.5% agarose gel containing 1X green viewer DNA stain (Pasrzama, Tehran, Iran) (Su et al., 2016).

2.7 Statistical analysis

Data analysis was performed using the SPSS software version 16 and Fisher’s exact test. The significance level was considered at P < 0.05.

3 Results and discussion

According to our results, 116 (77.33%) out of 150 chicken were contaminated with E. coli, including 34 (22.66%) samples of whole chicken, 36 (24%) samples of sliced non-spicy chicken, and 46 (30.66%) samples of sliced-spicy chicken. The results of the antibiotic susceptibility test are presented in Table 2. About 28.81% of the E. coli isolates had MDR. The highest antibiotic resistance of E. coli isolates was observed to trimethoprim/sulfamethoxazole (46%), ampicillin (40%), and amoxicillin/clavulanate (29.33%). The most effective agent was meropenem (0%). Moreover, no significant relationship was seen between chicken preparation (sliced or whole and spicy or non-spicy) and antibiotic susceptibility (P > 0.05).

Table 2.

Antibiotic susceptibility patterns in E. coli isolates from chicken based on preparation types

AntibioticWhole chickenSliced, non-spicy chickenSliced, spicy chickenP value
R × n (%)I × n (%)S × n (%)R × n (%)I × n (%)S × n (%)R × n (%)I × n (%)S × n (%)
Cefotaxime4 (3.39%)2 (1.69%)28 (23.72%)2 (1.69%)3 (2.54%)31 (26.27%)1 (0.84%)0 (0%)47 (39.83%)0.07
Cefepime0 (0%)1 (0.84%)33 (27.96%)1 (0.84%)1 (0.84%)34 (28.81%)0 (0%)5 (4.24%)43 (36.44%)0.3
Amoxicillin/Clavulanate15 (12.71%)8 (6.78%)11 (9.32%)14 (11.86%)7 (5.93%)15 (12.71%)15 (12.71%)11 (9.32%)22 (18.64%)0.7
Trimethoprim/Sulfamethoxazole25 (21.18%)0 (0%)9 (7.62%)20 (16.94%)0 (0%)16 (13.56%)26 (22.03%)2 (1.69%)20 (16.94%)0.2
Meropenem0 (0%)1 (0.84%)33 (27.96%)0 (0%)0 (0%)36 (30.5%)0 (0%)0 (0%)48 (40.67%)0.3
Imipenem3 (2.54%)12 (10.17%)19 (16.1%)2 (1.69%)6 (5.08%)28 (23.72%)2 (1.69%)13 (11.01%)33 (27.69%)0.3
Ampicillin18 (15.25%)2 (1.69%)14 (11.86%)17 (14.4%)10 (8.47%)9 (7.63%)26 (22.03%)12 (10.17%)10 (8.47%)0.07
Gentamicin1 (0.84%)1 (0.84%)32 (27.12%)1 (0.84%)1 (0.84%)34 (28.81%)0 (0%)0 (0%)48 (40.67%)0.4

R: resistant; I: intermediate; S: sensitive.

In the CDT, 17 E. coli isolates (11.33%) were considered ESBL producers. Moreover, only one isolate (0.66%) showed complete resistance to cefoxitin and was considered as potentially positive for AmpC.

In the molecular step, among 17 (11.33%) strains, five (3.33%) E. coli strains had blaCTX-M14 gene, two samples were contaminated with the strains having blaDHA gene (1.33%), two samples had E. coli strains with blaCTX-M3 gene (1.33%), and just one sample contained blaCMY-2 gene (0.66%). The blaSHV and blaTEM genes were not detected in any isolates. Moreover, there was no significant difference between the chicken preparation type and the frequency of the mentioned genes (P > 0.05). Figure 1 shows the amplified genes in E. coli strains.

Fig. 1.
Fig. 1.

Detection of B-lactamase genes in E. coli isolates; Lane 1: 50 base-pair DNA ladder; Lane 2 to 14: chicken samples; Lane 15: Positive control of K. pneumoniae ATCC700603; Lane 16: Positive control of E. coli ATCC25922; Lane 17: Negative control

Citation: Acta Alimentaria 52, 1; 10.1556/066.2022.00164

In the present study, trimethoprim/sulfamethoxazole showed the highest resistance rate (46%), while the lowest resistance was observed for meropenem (0%). Moreover, ampicillin (40%) and amoxicillin/clavulanic acid (29.33%) showed high resistance rates. Al-Ghamdi et al. (1999) worked on 119 samples of healthy broiler and 100 samples of sick broiler and reported high resistance to ampicillin, gentamicin, and trimethoprim/sulfamethoxazole. In addition, the resistance to ceftazidime was 0% and 8.70% in healthy and sick broiler samples, respectively. There was also a low resistance to amoxicillin/clavulanic acid (Al-Ghamdi et al., 1999). In the present study, the resistance to gentamicin was very low, which is incompatible with the study by Al-Ghamdi et al. However, the resistance to amoxicillin in our study was similar to the mentioned study. Another study by Sáenz et al. (2001) on human and animal models and food samples reported high resistance to gentamicin, ampicillin, and trimethoprim/sulfamethoxazole in the bacteria isolated from the broiler faecal samples (Sáenz et al., 2001). In addition, resistance to imipenem, cefoxitin, cefotaxime, and ceftazidime was almost zero (Ryu et al., 2012a). A study by Gregova et al. (2012) reported high resistance to ampicillin (89%). Moreover, 43% of the samples were resistant to gentamicin (Gregova et al., 2012). These two studies were incompatible with the present study in the resistance to gentamicin, which can be due to different geographical areas, used antibiotics in the farms, and samples type (Kargar et al., 2013).

A study by Klimienė et al. (2017) on chicken showed high resistance to ceftazidime and ampicillin, while the resistance to cefoxitin, imipenem, meropenem, and trimethoprim/sulfamethoxazole was 0% (Klimienė et al., 2017). However, the resistance to trimethoprim/sulfamethoxazole was relatively high in the present study. Another study by Miles et al. (2006) reported that 20% of the samples were resistant to ampicillin, while the resistance to gentamicin was 0% (Miles et al., 2006). Another study by Ryu et al. (2012a) on food samples reported that from a total of 96 samples contaminated with E. coli, only 10% were resistant to ampicillin, while the resistance to other antibiotics was negligible (Ryu et al., 2012a). These findings are not the same as in the present study in the rate of ampicillin resistance, which was reported to be 52%. The present study agreed with most of the mentioned studies in the high resistance to ampicillin and trimethoprim/sulfamethoxazole and low resistance to imipenem, meropenem, and cefotaxime. However, our findings were disagreed with most previous studies on the resistance to gentamicin, which can be due to different samples, diversely used antibiotics in each area, the prevalence of contamination with E. coli, and others (Kargar et al., 2013).

In the current study, 3.33% of E. coli strains contained blaCTX-M14 gene, 1.33% carried blaDHA gene, 1.33% had blaCTX-M3 gene, and just 0.66% of E. coli had blaCMY-2 gene. In total, 4.66% were positive for ESBL, and 1.33% was positive for AmpC. Moreover, blaSHV and blaTEM genes were not observed in any strains isolated from the chicken samples. Batabyal et al. (2018) reported that 100% of the samples had the blaCTX-M gene (Batabyal et al., 2018), while Müller et al. (2018) showed that 22% of the samples carried the blaCMY-2 gene (Müller et al., 2018), which was inconsistent with the present study. Moreover, Klimiené et al. (2017) reported that almost half of the samples had the blaSHV gene, while the prevalence of blaTEM and blaCTX-M was 70% and 80%, respectively (Kargar et al., 2013). According to Overdevest et al. (2011), 14% of the chicken samples had blaTEM gene, 15% carried the blaSHV gene, and 66% had the blaCTX-M group genes (Overdevest et al., 2011), which was incongruous with the present study. According to the study of Su et al. (2016) that investigated milk samples, prevalence of blaSHV, blaTEM, blaCTX-M3, blaCTX-M14, blaCMY, and blaDHA were reported as 9%, 40%, 9%, 4%, 40%, and 2%, respectively (Su et al., 2016). In the study of Ojer-Usoz et al. (2017) on food samples, blaCTX-M14, blaTEM and blaSHV was reported as 25%, 12.5%, and 18.5%, respectively (Ojer-Usoz et al., 2017). Another study by Ryu et al. (2012b) reported no samples carrying the blaSHV gene, while the prevalence of blaTEM genes was slight (Ryu et al., 2012a, 2012b), which is compatible with the present study in the low prevalence of blaSHV and blaTEM genes. In the mentioned studies, the prevalence of blaSHV and blaTEM genes was low or even 0%, while the prevalence of blaCTX-M, blaCMY-2, and blaDHA genes was higher, which disagreed with the present study. This can be due to the presence of different bacterial colonies in those environments and specific types of samples (Kargar et al., 2013).

The present study showed a high prevalence of contamination with resistant E. coli in the chicken present in the markets of Birjand. This problem can be due to various reasons, including not following the hygiene by the related staff, unsanitary processing, packaging, storage, and use of water contaminated with E. coli for washing the chicken.

4 Conclusions

The present study showed the high contamination of chicken with antibiotic-resistant E. coli, including ESBL- and AmpC-producing strains. So, use of antibiotics in poultry production must be more precautious.

Acknowledgment

This study was a Master of Science thesis financially supported by Birjand University of Medical Sciences (455985).

References

  • Akond, M.A., Hassan, S.M.R., Alam, S., and Shirin, M. (2009). Antibiotic resistance of Escherichia coli isolated from poultry and poultry environment of Bangladesh. American Journal of Environmental Sciences, 5(1): 4752.

    • Search Google Scholar
    • Export Citation
  • Al-Ghamdi, M.S., El-Morsy, F., Al-Mustafa, Z.H., Al-Ramadhan, M., and Hanif, M. (1999). Antibiotic resistance of Escherichia coli isolated from poultry workers, patients and chicken in the eastern province of Saudi Arabia. Tropical Medicine and International Health, 4(4): 278283.

    • Search Google Scholar
    • Export Citation
  • Barilli, E., Vismarra, A., Villa, Z., Bonilauri, P., and Bacci, C. (2019). ESβL E. coli isolated in pigs chain: genetic analysis associated to the phenotype and biofilm synthesis evaluation. International Journal of Food Microbiology, 289: 162167.

    • Search Google Scholar
    • Export Citation
  • Batabyal, K., Banerjee, A., Pal, S., Dey, S., Joardar, S.N., Samanta, I., Isore, D.P., and Singh, A.D. (2018). Detection, characterization, and antibiogram of extended-spectrum beta-lactamase Escherichia coli isolated from bovine milk samples in West Bengal, India. Veterinary World, 11(10): 14231427.

    • Search Google Scholar
    • Export Citation
  • Biasino, W., Zutter, L.D., Garcia-Graells, C., Uyttendaele, M., Botteldoorn, N., Gowda, T., and Damme, I.V., (2018). Quantification, distribution and diversity of ESBL/AmpC-producing Escherichia coli on freshly slaughtered pig carcasses. International Journal of Food Microbiology, 281: 3235.

    • Search Google Scholar
    • Export Citation
  • CLSI (2018). Performance standards for antimicrobial susceptibility testing; 18th informational supplement. M100–S28. Clinical and Laboratory Standards Institute, Wayne, PA, USA.

    • Search Google Scholar
    • Export Citation
  • Feng, P., Weagant, S.D., and Jinneman, K. (2020). BAM chapter 4A: diarrheagenic Escherichia coli .Updated July 2020. Available at: https://www.fda.gov/food/laboratory-methods-food/bam-chapter-4a-diarrheagenic-escherichia-coli (Last accessed: 17 February 2023).

    • Search Google Scholar
    • Export Citation
  • Gregova, G., Kmetova, M., Kmet, V., Venglovsky, J., and Feher, A. (2012). Antibiotic resistance of Escherichia coli isolated from a poultry slaughterhouse. Annals of Agricultural and Environmental Medicine, 19(1): 7577.

    • Search Google Scholar
    • Export Citation
  • Hosseini, H., Jamshidi, A., Basssami, M.R., Khaksar, R., Zeynali, T., Mousavi Khaneghah, A., and Khanzadi, S. (2013). Isolation, identification and virulence gene profiling of Escherichia coli O157: H7 in retail doner kebabs, Iran. Journal of Food Safety, 33(4): 489496.

    • Search Google Scholar
    • Export Citation
  • Jamshidi, A., Rad, M., and Zeinali, T. (2015). Detection of Shiga toxin-producing Escherichia coli (STEC) in faeces of healthy calves in Mashhad, Iran. Archives of Razi Institute, 70(3): 179185.

    • Search Google Scholar
    • Export Citation
  • Kargar, M., Dianati, P., Homayoon, M., and Jamali, H. (2013). Isolation, characterization and antibiotic resistance of shiga toxin-producing Escherichia coli in hamburger and evolution of virulence genes stx1, stx2, eaeA and hly by multiplex PCR. Journal of Fasa University of Medical Sciences, 3(3): 208214. (In Persian with English abstract).

    • Search Google Scholar
    • Export Citation
  • Klimienė, I., Virgailis, M., Kerzienė, S., Šiugždinienė, R., Mockeliūnas, R., and Ruzauskas, M. (2017). Evaluation of genotypical antimicrobial resistance in ESBL producing Escherichia coli phylogenetic groups isolated from retail poultry meat. Journal of Food Safety, 38(1): e12370.

    • Search Google Scholar
    • Export Citation
  • Miles, T.D., McLaughlin, W., and Brown, P.D. (2006). Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. BMC Veterinary Research, 2: 7.

    • Search Google Scholar
    • Export Citation
  • Motallebi, M., Piroozmand, A., Rohani, M., Akbari, H., and Khorshidi, A. (2011). Prevalence and multi-drug resistance of enteropathogenic Escherichia coli (EPEC) isolated from children under 5 years of age with diarrhea in Kashan Shahid Beheshti Hospital during 2009–10. FEYZ, 15(1): 5865. (In Persian with English abstract).

    • Search Google Scholar
    • Export Citation
  • Müller, A., Jansen, W., Grabowski, N.T., Monecke, S., Ehricht, R., and Kehrenberg, C. (2018). ESBL- and AmpC-producing Escherichia coli from legally and illegally imported meat: characterization of isolates brought into the EU from third countries. International Journal of Food Microbiology, 283: 5258.

    • Search Google Scholar
    • Export Citation
  • Ogbolu, D., Alli, O., Olanipekun, L., Ojo, O., and Makinde, O. (2013). Faecal carriage of extended-spectrum beta-lactamase (ESBL)-producing commensal Klebsiella pneumoniae and Escherichia coli from hospital out-patients in Southern Nigeria. International Journal of Medicine and Medical Sciences, 5(3): 97105.

    • Search Google Scholar
    • Export Citation
  • Ojer-Usoz, E., González, D., and Vitas, A.I. (2017). Clonal diversity of ESBL-producing Escherichia coli isolated from environmental, human and food samples. International Journal of Environmental Research and Public Health, 14(7): 676.

    • Search Google Scholar
    • Export Citation
  • Overdevest, I., Willemsen, I., Rijnsburger, M., Eustace, A., Xu, L., Hawkey, P., Heck, M., Savelkoul, P., Vandenbroucke-Grauls, C., Zwaluw, K. van der, Huijsdens, X., and Kluytmans, J. (2011). Extended-spectrum β-lactamase genes of Escherichia coli in chicken meat and humans, The Netherlands. Emerging Infectious Diseases, 17(7): 12161222.

    • Search Google Scholar
    • Export Citation
  • Peter-Getzlaff, S., Polsfuss, S., Poledica, M., Hombach, M., Giger, J., Böttger, E.C., Zbinden, R., and Bloemberg, G.V. (2011). Detection of AmpC beta-lactamase in Escherichia coli: comparison of three phenotypic confirmation assays and genetic analysis. Journal of Clinical Microbiology, 49(8): 29242932.

    • Search Google Scholar
    • Export Citation
  • Ryu, S.-H., Lee, J.-H., Park, S.-H., Song, M.-O., Park, S.-H., Jung, H.-W., Park, G.-Y., Choi, S.-M., Kim, M.-S., Chae, Y.-Z., Park, S.-G., and Lee, Y.-K. (2012a). Antimicrobial resistance profiles among Escherichia coli strains isolated from commercial and cooked foods. International Journal of Food Microbiology, 159(3): 263266.

    • Search Google Scholar
    • Export Citation
  • Ryu, S.-H., Park, S.-G., Choi, S.-M., Hwang, Y.-O., Ham, H.-J., Kim, S.-U., Lee, Y.-K., Kim, M.-S., Park, G.-Y., Kim, K.-S., and Chae, Y.-Z. (2012b). Antimicrobial resistance and resistance genes in Escherichia coli strains isolated from commercial fish and seafood. International Journal of Food Microbiology, 152(1–2): 1418.

    • Search Google Scholar
    • Export Citation
  • Saei, M., Jamshidi, A., Zeinali, T., and Khoramian, B. (2022). Phenotypic and genotypic determination of β-lactamase-producing Escherichia coli strains isolated from raw milk and clinical mastitis samples, Mashhad, Iran. International Dairy Journal, 133: 105406.

    • Search Google Scholar
    • Export Citation
  • Sáenz, Y., Zarazaga, M., Briñas, L., Lantero, M., Ruiz-Larrea, F., and Torres, C. (2001). Antibiotic resistance in Escherichia coli isolates obtained from animals, foods and humans in Spain. International Journal of Antimicrobial Agents, 18: 353358.

    • Search Google Scholar
    • Export Citation
  • Su, Y., Yu, C.-Y., Tsai, Y., Wang, S.-H., Lee, C., and Chu, C. (2016). Fluoroquinolone-resistant and extended-spectrum β-lactamase-producing Escherichia coli from the milk of cows with clinical mastitis in Southern Taiwan. Journal of Microbiology, Immunology, and Infection, 49(6): 892901.

    • Search Google Scholar
    • Export Citation
  • Akond, M.A., Hassan, S.M.R., Alam, S., and Shirin, M. (2009). Antibiotic resistance of Escherichia coli isolated from poultry and poultry environment of Bangladesh. American Journal of Environmental Sciences, 5(1): 4752.

    • Search Google Scholar
    • Export Citation
  • Al-Ghamdi, M.S., El-Morsy, F., Al-Mustafa, Z.H., Al-Ramadhan, M., and Hanif, M. (1999). Antibiotic resistance of Escherichia coli isolated from poultry workers, patients and chicken in the eastern province of Saudi Arabia. Tropical Medicine and International Health, 4(4): 278283.

    • Search Google Scholar
    • Export Citation
  • Barilli, E., Vismarra, A., Villa, Z., Bonilauri, P., and Bacci, C. (2019). ESβL E. coli isolated in pigs chain: genetic analysis associated to the phenotype and biofilm synthesis evaluation. International Journal of Food Microbiology, 289: 162167.

    • Search Google Scholar
    • Export Citation
  • Batabyal, K., Banerjee, A., Pal, S., Dey, S., Joardar, S.N., Samanta, I., Isore, D.P., and Singh, A.D. (2018). Detection, characterization, and antibiogram of extended-spectrum beta-lactamase Escherichia coli isolated from bovine milk samples in West Bengal, India. Veterinary World, 11(10): 14231427.

    • Search Google Scholar
    • Export Citation
  • Biasino, W., Zutter, L.D., Garcia-Graells, C., Uyttendaele, M., Botteldoorn, N., Gowda, T., and Damme, I.V., (2018). Quantification, distribution and diversity of ESBL/AmpC-producing Escherichia coli on freshly slaughtered pig carcasses. International Journal of Food Microbiology, 281: 3235.

    • Search Google Scholar
    • Export Citation
  • CLSI (2018). Performance standards for antimicrobial susceptibility testing; 18th informational supplement. M100–S28. Clinical and Laboratory Standards Institute, Wayne, PA, USA.

    • Search Google Scholar
    • Export Citation
  • Feng, P., Weagant, S.D., and Jinneman, K. (2020). BAM chapter 4A: diarrheagenic Escherichia coli .Updated July 2020. Available at: https://www.fda.gov/food/laboratory-methods-food/bam-chapter-4a-diarrheagenic-escherichia-coli (Last accessed: 17 February 2023).

    • Search Google Scholar
    • Export Citation
  • Gregova, G., Kmetova, M., Kmet, V., Venglovsky, J., and Feher, A. (2012). Antibiotic resistance of Escherichia coli isolated from a poultry slaughterhouse. Annals of Agricultural and Environmental Medicine, 19(1): 7577.

    • Search Google Scholar
    • Export Citation
  • Hosseini, H., Jamshidi, A., Basssami, M.R., Khaksar, R., Zeynali, T., Mousavi Khaneghah, A., and Khanzadi, S. (2013). Isolation, identification and virulence gene profiling of Escherichia coli O157: H7 in retail doner kebabs, Iran. Journal of Food Safety, 33(4): 489496.

    • Search Google Scholar
    • Export Citation
  • Jamshidi, A., Rad, M., and Zeinali, T. (2015). Detection of Shiga toxin-producing Escherichia coli (STEC) in faeces of healthy calves in Mashhad, Iran. Archives of Razi Institute, 70(3): 179185.

    • Search Google Scholar
    • Export Citation
  • Kargar, M., Dianati, P., Homayoon, M., and Jamali, H. (2013). Isolation, characterization and antibiotic resistance of shiga toxin-producing Escherichia coli in hamburger and evolution of virulence genes stx1, stx2, eaeA and hly by multiplex PCR. Journal of Fasa University of Medical Sciences, 3(3): 208214. (In Persian with English abstract).

    • Search Google Scholar
    • Export Citation
  • Klimienė, I., Virgailis, M., Kerzienė, S., Šiugždinienė, R., Mockeliūnas, R., and Ruzauskas, M. (2017). Evaluation of genotypical antimicrobial resistance in ESBL producing Escherichia coli phylogenetic groups isolated from retail poultry meat. Journal of Food Safety, 38(1): e12370.

    • Search Google Scholar
    • Export Citation
  • Miles, T.D., McLaughlin, W., and Brown, P.D. (2006). Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. BMC Veterinary Research, 2: 7.

    • Search Google Scholar
    • Export Citation
  • Motallebi, M., Piroozmand, A., Rohani, M., Akbari, H., and Khorshidi, A. (2011). Prevalence and multi-drug resistance of enteropathogenic Escherichia coli (EPEC) isolated from children under 5 years of age with diarrhea in Kashan Shahid Beheshti Hospital during 2009–10. FEYZ, 15(1): 5865. (In Persian with English abstract).

    • Search Google Scholar
    • Export Citation
  • Müller, A., Jansen, W., Grabowski, N.T., Monecke, S., Ehricht, R., and Kehrenberg, C. (2018). ESBL- and AmpC-producing Escherichia coli from legally and illegally imported meat: characterization of isolates brought into the EU from third countries. International Journal of Food Microbiology, 283: 5258.

    • Search Google Scholar
    • Export Citation
  • Ogbolu, D., Alli, O., Olanipekun, L., Ojo, O., and Makinde, O. (2013). Faecal carriage of extended-spectrum beta-lactamase (ESBL)-producing commensal Klebsiella pneumoniae and Escherichia coli from hospital out-patients in Southern Nigeria. International Journal of Medicine and Medical Sciences, 5(3): 97105.

    • Search Google Scholar
    • Export Citation
  • Ojer-Usoz, E., González, D., and Vitas, A.I. (2017). Clonal diversity of ESBL-producing Escherichia coli isolated from environmental, human and food samples. International Journal of Environmental Research and Public Health, 14(7): 676.

    • Search Google Scholar
    • Export Citation
  • Overdevest, I., Willemsen, I., Rijnsburger, M., Eustace, A., Xu, L., Hawkey, P., Heck, M., Savelkoul, P., Vandenbroucke-Grauls, C., Zwaluw, K. van der, Huijsdens, X., and Kluytmans, J. (2011). Extended-spectrum β-lactamase genes of Escherichia coli in chicken meat and humans, The Netherlands. Emerging Infectious Diseases, 17(7): 12161222.

    • Search Google Scholar
    • Export Citation
  • Peter-Getzlaff, S., Polsfuss, S., Poledica, M., Hombach, M., Giger, J., Böttger, E.C., Zbinden, R., and Bloemberg, G.V. (2011). Detection of AmpC beta-lactamase in Escherichia coli: comparison of three phenotypic confirmation assays and genetic analysis. Journal of Clinical Microbiology, 49(8): 29242932.

    • Search Google Scholar
    • Export Citation
  • Ryu, S.-H., Lee, J.-H., Park, S.-H., Song, M.-O., Park, S.-H., Jung, H.-W., Park, G.-Y., Choi, S.-M., Kim, M.-S., Chae, Y.-Z., Park, S.-G., and Lee, Y.-K. (2012a). Antimicrobial resistance profiles among Escherichia coli strains isolated from commercial and cooked foods. International Journal of Food Microbiology, 159(3): 263266.

    • Search Google Scholar
    • Export Citation
  • Ryu, S.-H., Park, S.-G., Choi, S.-M., Hwang, Y.-O., Ham, H.-J., Kim, S.-U., Lee, Y.-K., Kim, M.-S., Park, G.-Y., Kim, K.-S., and Chae, Y.-Z. (2012b). Antimicrobial resistance and resistance genes in Escherichia coli strains isolated from commercial fish and seafood. International Journal of Food Microbiology, 152(1–2): 1418.

    • Search Google Scholar
    • Export Citation
  • Saei, M., Jamshidi, A., Zeinali, T., and Khoramian, B. (2022). Phenotypic and genotypic determination of β-lactamase-producing Escherichia coli strains isolated from raw milk and clinical mastitis samples, Mashhad, Iran. International Dairy Journal, 133: 105406.

    • Search Google Scholar
    • Export Citation
  • Sáenz, Y., Zarazaga, M., Briñas, L., Lantero, M., Ruiz-Larrea, F., and Torres, C. (2001). Antibiotic resistance in Escherichia coli isolates obtained from animals, foods and humans in Spain. International Journal of Antimicrobial Agents, 18: 353358.

    • Search Google Scholar
    • Export Citation
  • Su, Y., Yu, C.-Y., Tsai, Y., Wang, S.-H., Lee, C., and Chu, C. (2016). Fluoroquinolone-resistant and extended-spectrum β-lactamase-producing Escherichia coli from the milk of cows with clinical mastitis in Southern Taiwan. Journal of Microbiology, Immunology, and Infection, 49(6): 892901.

    • Search Google Scholar
    • Export Citation
  • Collapse
  • Expand

 

The author instruction is available in PDF.
Please, download the file from HERE.

Senior editors

Editor(s)-in-Chief: András Salgó

Co-ordinating Editor(s) Marianna Tóth-Markus

Co-editor(s): A. Halász

       Editorial Board

  • L. Abrankó (Szent István University, Gödöllő, Hungary)
  • D. Bánáti (University of Szeged, Szeged, Hungary)
  • J. Baranyi (Institute of Food Research, Norwich, UK)
  • I. Bata-Vidács (Agro-Environmental Research Institute, National Agricultural Research and Innovation Centre, Budapest, Hungary)
  • F. Békés (FBFD PTY LTD, Sydney, NSW Australia)
  • Gy. Biró (National Institute for Food and Nutrition Science, Budapest, Hungary)
  • A. Blázovics (Semmelweis University, Budapest, Hungary)
  • F. Capozzi (University of Bologna, Bologna, Italy)
  • M. Carcea (Research Centre for Food and Nutrition, Council for Agricultural Research and Economics Rome, Italy)
  • Zs. Cserhalmi (Food Science Research Institute, National Agricultural Research and Innovation Centre, Budapest, Hungary)
  • M. Dalla Rosa (University of Bologna, Bologna, Italy)
  • I. Dalmadi (Szent István University, Budapest, Hungary)
  • K. Demnerova (University of Chemistry and Technology, Prague, Czech Republic)
  • M. Dobozi King (Texas A&M University, Texas, USA)
  • Muying Du (Southwest University in Chongqing, Chongqing, China)
  • S. N. El (Ege University, Izmir, Turkey)
  • S. B. Engelsen (University of Copenhagen, Copenhagen, Denmark)
  • E. Gelencsér (Food Science Research Institute, National Agricultural Research and Innovation Centre, Budapest, Hungary)
  • V. M. Gómez-López (Universidad Católica San Antonio de Murcia, Murcia, Spain)
  • J. Hardi (University of Osijek, Osijek, Croatia)
  • K. Héberger (Research Centre for Natural Sciences, ELKH, Budapest, Hungary)
  • N. Ilić (University of Novi Sad, Novi Sad, Serbia)
  • D. Knorr (Technische Universität Berlin, Berlin, Germany)
  • H. Köksel (Hacettepe University, Ankara, Turkey)
  • K. Liburdi (Tuscia University, Viterbo, Italy)
  • M. Lindhauer (Max Rubner Institute, Detmold, Germany)
  • M.-T. Liong (Universiti Sains Malaysia, Penang, Malaysia)
  • M. Manley (Stellenbosch University, Stellenbosch, South Africa)
  • M. Mézes (Szent István University, Gödöllő, Hungary)
  • Á. Németh (Budapest University of Technology and Economics, Budapest, Hungary)
  • P. Ng (Michigan State University,  Michigan, USA)
  • Q. D. Nguyen (Szent István University, Budapest, Hungary)
  • L. Nyström (ETH Zürich, Switzerland)
  • L. Perez (University of Cordoba, Cordoba, Spain)
  • V. Piironen (University of Helsinki, Finland)
  • A. Pino (University of Catania, Catania, Italy)
  • M. Rychtera (University of Chemistry and Technology, Prague, Czech Republic)
  • K. Scherf (Technical University, Munich, Germany)
  • R. Schönlechner (University of Natural Resources and Life Sciences, Vienna, Austria)
  • A. Sharma (Department of Atomic Energy, Delhi, India)
  • A. Szarka (Budapest University of Technology and Economics, Budapest, Hungary)
  • M. Szeitzné Szabó (National Food Chain Safety Office, Budapest, Hungary)
  • S. Tömösközi (Budapest University of Technology and Economics, Budapest, Hungary)
  • L. Varga (University of West Hungary, Mosonmagyaróvár, Hungary)
  • R. Venskutonis (Kaunas University of Technology, Kaunas, Lithuania)
  • B. Wróblewska (Institute of Animal Reproduction and Food Research, Polish Academy of Sciences Olsztyn, Poland)

 

Acta Alimentaria
E-mail: Acta.Alimentaria@uni-mate.hu

Indexing and Abstracting Services:

  • Biological Abstracts
  • BIOSIS Previews
  • CAB Abstracts
  • CABELLS Journalytics
  • Chemical Abstracts
  • Current Contents: Agriculture, Biology and Environmental Sciences
  • Elsevier Science Navigator
  • Essential Science Indicators
  • Global Health
  • Index Veterinarius
  • Science Citation Index
  • Science Citation Index Expanded (SciSearch)
  • SCOPUS
  • The ISI Alerting Services

2021  
Web of Science  
Total Cites
WoS
856
Journal Impact Factor 1,000
Rank by Impact Factor Food Science & Technology 130/143
Nutrition & Dietetics 81/90
Impact Factor
without
Journal Self Cites
0,941
5 Year
Impact Factor
1,039
Journal Citation Indicator 0,19
Rank by Journal Citation Indicator Food Science & Technology 143/164
Nutrition & Dietetics 92/109
Scimago  
Scimago
H-index
30
Scimago
Journal Rank
0,235
Scimago Quartile Score

Food Science (Q3)

Scopus  
Scopus
Cite Score
1,4
Scopus
CIte Score Rank
Food Sciences 222/338 (Q3)
Scopus
SNIP
0,387

 

2020
 
Total Cites
768
WoS
Journal
Impact Factor
0,650
Rank by
Nutrition & Dietetics 79/89 (Q4)
Impact Factor
Food Science & Technology 130/144 (Q4)
Impact Factor
0,575
without
Journal Self Cites
5 Year
0,899
Impact Factor
Journal
0,17
Citation Indicator
 
Rank by Journal
Nutrition & Dietetics 88/103 (Q4)
Citation Indicator
Food Science & Technology 142/160 (Q4)
Citable
59
Items
Total
58
Articles
Total
1
Reviews
Scimago
28
H-index
Scimago
0,237
Journal Rank
Scimago
Food Science Q3
Quartile Score
 
Scopus
248/238=1,0
Scite Score
 
Scopus
Food Science 216/310 (Q3)
Scite Score Rank
 
Scopus
0,349
SNIP
 
Days from
100
submission
 
to acceptance
 
Days from
143
acceptance
 
to publication
 
Acceptance
16%
Rate
2019  
Total Cites
WoS
522
Impact Factor 0,458
Impact Factor
without
Journal Self Cites
0,433
5 Year
Impact Factor
0,503
Immediacy
Index
0,100
Citable
Items
60
Total
Articles
59
Total
Reviews
1
Cited
Half-Life
7,8
Citing
Half-Life
9,8
Eigenfactor
Score
0,00034
Article Influence
Score
0,077
% Articles
in
Citable Items
98,33
Normalized
Eigenfactor
0,04267
Average
IF
Percentile
7,429
Scimago
H-index
27
Scimago
Journal Rank
0,212
Scopus
Scite Score
220/247=0,9
Scopus
Scite Score Rank
Food Science 215/299 (Q3)
Scopus
SNIP
0,275
Acceptance
Rate
15%

 

Acta Alimentaria
Publication Model Hybrid
Submission Fee none
Article Processing Charge 1100 EUR/article
Printed Color Illustrations 40 EUR (or 10 000 HUF) + VAT / piece
Regional discounts on country of the funding agency World Bank Lower-middle-income economies: 50%
World Bank Low-income economies: 100%
Further Discounts Editorial Board / Advisory Board members: 50%
Corresponding authors, affiliated to an EISZ member institution subscribing to the journal package of Akadémiai Kiadó: 100%
Subscription fee 2023 Online subsscription: 776 EUR / 944 USD
Print + online subscription: 896 EUR / 1090 USD
Subscription Information Online subscribers are entitled access to all back issues published by Akadémiai Kiadó for each title for the duration of the subscription, as well as Online First content for the subscribed content.
Purchase per Title Individual articles are sold on the displayed price.

Acta Alimentaria
Language English
Size B5
Year of
Foundation
1972
Volumes
per Year
1
Issues
per Year
4
Founder Magyar Tudományos Akadémia    
Founder's
Address
H-1051 Budapest, Hungary, Széchenyi István tér 9.
Publisher Akadémiai Kiadó
Publisher's
Address
H-1117 Budapest, Hungary 1516 Budapest, PO Box 245.
Responsible
Publisher
Chief Executive Officer, Akadémiai Kiadó
ISSN 0139-3006 (Print)
ISSN 1588-2535 (Online)

 

Monthly Content Usage

Abstract Views Full Text Views PDF Downloads
Dec 2022 0 0 0
Jan 2023 0 0 0
Feb 2023 0 0 0
Mar 2023 0 95 44
Apr 2023 0 49 48
May 2023 0 58 54
Jun 2023 0 8 16