General Experimental Procedures

Melting point (uncorrected) was determined on an electrothermal apparatus. ¹H-, ¹³C-NMR, ¹H-¹H COSY (COrrelated SpectroscopY), and ¹H-¹³C HMBC (Heteronuclear Multiple Bond Correlation) spectra were obtained using a pulse sequence supplied from Varian Mecauy 300 MHz spectrometer (¹H, 300 MHz and ¹³C, 75 MHz, in deuterated dimethylsulphoxide [DMSO-d₆]). Chemical shifts (δ) were given in values (ppm) relative to trimethylsilane (TMS) as an internal reference and coupling constant (J) in Hertz. All solvents and reagents used were of analytical grade. Sephadex LH-20 (25–100 μm, Pharmacia Fine Chemicals Inc., Uppsala, Sweden). Paper chromatography (PC) was carried out on Whatman No. 1 paper sheets (57 cm × 46 cm; Maidstone, England) (S₁, n-BuOH–AcOH–H₂O, 4:1:5 upper layer; S₂, H₂O–AcOH, 85:15). Spots were visualized under Vilber Lourmat UV lamp (VL-6LC France) at 254 and 365 nm and then sprayed with methanolic 1% FeCl₃ and/or 5% AlCl₃.

Media

The following media were used in the study: nutrient agar medium (DSMZ1) (beef extract, 3; peptone, 10; agar, 18–20; distilled water, 1000 mL; pH 7), Czapek-Dox (CD) agar medium (DSMZ 130) (sucrose, 30; NaNO₃, 3; MgSO₄⋅7H₂O, 0.5; FeSO₄⋅7H₂O, 0.01; K₂HPO₄, 1; KCl, 0.5; distilled water, 1000 mL; agar, 18–20).

Isolation of Terrestrial Fungi

Soil samples were collected in the surrounding of Mansoura Governorate, Egypt during May 2012; soil was taken at 10 cm depth. Samples were sieved and air dried for 3–5 days at 28 °C. After drying, samples were kept at 10 °C until used. Fungal strains were isolated from soil samples. Enumeration of the microbes present in the soil was done by serial dilution-agar plating method. Serial dilution of soil suspension was prepared up to 10⁻⁶ dilution. Then, 0.1 mL of suspension from dilutions 10⁻³ to 10⁻⁶ was transferred to the petri dishes containing CD agar medium at 28 ± 2 °C for 6–8 days, and growth was observed after 2 days. The fungi isolated on culture medium from soil were purified by spore suspension and streak method. The cultures were routinely transferred (every 6–8 days) onto fresh CD agar plates by streaking. Before fungal cultures were used for inoculation of liquid growth medium, the fungus was subjected to three transfers on CD agar plates by the direct agar transfer method [9].

Scale up Fermentation, and Extraction

Scale-up fermentation has been maintained using 15 Erlenmeyer flasks (1 L volume); each contains 100 g rice and 100 mL distilled water, sterilized at 121 °C (15 lb) for 20 min. Each flask was inoculated with spore suspension from 1 slant (10 days old). After incubation at 30 °C for 15 days, the medium was extracted with ethyl acetate several times till exhaustion. A reddish brown extract was produced (≅20 g).

Fungal Identification

Fungal isolate (3T) was identified by DNA isolation, amplification by polymerase chain reaction (PCR), and sequencing of the internal transcribed spacer (ITS) region. The primers ITS2 (GCTGCGTTCTTCATCGATGC) and ITS3 (GCATCGATGAAGAACGCAGC) were used for PCR amplification while ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were taken for sequencing. Candida sp. was tested as control. The sequence data were submitted to GenBank. The fungal strain (3T) culture was reserved in the Microbial Chemistry Department Culture Collection of Microorganisms.

In vitro Antimicrobial Activity

Disc agar plate method has been established to evaluate the antimicrobial activities of different fractions as well as compound 7 that dissolved in methanol (MeOH) [10]. Four different test microbes, Staphylococcus aureus, Escherichia coli, Candida albicans, and Aspergillus niger, were selected to evaluate the antimicrobial activities as representatives of Gram+ bacteria, Gram− bacteria, yeast, and fungal groups, respectively. The bacterial and yeast test microbes were grown on a nutrient agar medium. On the other hand, the fungal test microbe was cultivated on Czapek-Dox medium. The culture of each test microbe was diluted by distilled water (sterilized) to 10⁷ to 10⁸ colony forming units (CFUs)/mL, and then 1 mL of each was used to inoculate 1 L Erlenmeyer flask containing 250 mL of solidified agar media. These media were put onto previously sterilized Petri dishes (10 cm diameter having 25 mL of solidified media). Filter paper discs (5 mm Ø, Whatman No. 1 filter paper) loaded with 0.2 mg of each extract and 100 μg of pure sample. The discs were dried at room temperature under sterilized conditions. The paper discs were placed on agar plates seeded with test microbes and incubated for 24 h, at the appropriate temperature of each test organism. Antimicrobial activities were recorded as the diameter of the clear zones (including the disc itself) that appeared around the discs [11].

Isolation and Purification of Secondary Metabolites

The ethyl acetate (EtOAc) extract was evaporated to dryness to give a brownish mass (20 g) and then underwent fractionation using VLC on silica gel 60 using solvents in a gradient of increasing polarity; n-hexane–ethyl acetate, dichloromethane–methanol (CH₂Cl₂–MeOH), and 100% acetone step gradient elution to afford thirteen fractions eluted from the VLC as follows: fractions 1–6 were eluted by n-hexane–EtOAc; 100:0–80:20–60:40–40:60–20:80–80:20–0:100 (%v/v), respectively, for the fractions 1–6; also, fractions 7–12 were eluted by CH₂Cl₂–MeOH; 100:0–80:20–60:40–40:60–20:80–80:20–0:100 (%v/v), respectively, for the fractions 7–12, finally fraction (13) was eluted by 100% acetone. The in vitro antimicrobial activity of these fractions was evaluated; among them, the most promising fraction was undergoing further chromatographic isolation and purification via size exclusion chromatography using Sephadex LH-20 column (30 × 2 cm) eluted with 100% MeOH to afford eight pure compounds (Figure 1). In details, fraction 3 (1.5 g) was subjected to Sephadex LH-20 eluted with gradient mix elution system, CH₂Cl₂–MeOH till 100% MeOH; each sub-fraction was eluted as a single band to afford four compounds 1–4. On the other hand, fraction 4 (1.25 g) was subjected to Sephadex LH-20 column eluted with 100% MeOH to afford two compounds 5 and 6. Also, fraction 5 (1 g) was subjected to Sephadex LH-20 column eluted with 100% MeOH to afford compound 7. Finally, fraction 6 (0.75 g) was subjected to Sephadex LH-20 column eluted with 100% MeOH to afford compound 8.

View Full Size

Flow chart representing the cultivation, extraction, and purification of bioactive metabolites from fungus Aspergillus fumigatus 3T-EGY

Citation: Acta Chromatographica Acta Chromatographica 30, 4; 10.1556/1326.2017.00329

• Download Figure
• Download figure as PowerPoint slide

Identification of the Fungal Isolate 3T-EGY

Basic Local Alignment Search Tool (BLAST) search for the fungus isolate revealed 99% similarity to A. fumigatus. The phylogenic tree of this fungal isolate was also constructed (Figure 2). Based on the above identification techniques, our local soil fungal isolate was identified as A. fumigatus 3T-EGY with the GeneBank accession number KP140961 (http://www.ncbi.nlm.nih.gov/nuccore/KP140961.1). Conventional fungal identification protocols including morphological characteristics, growth on different media, and type of spores as well as biochemical behavior such as pigment production, etc. have been commonly applied, and several new species still now are identified according to this methods [12]. However, these methods take long time, have low sensitivity, difficult to control, and non-specific [13, 14]. Targeting specific regions within the ribosomal RNA gene clusters using universal primers through PCR amplification is another optional method for the fungal identification to the species level and also for analyzing fungal diversity [15]. In this context, internal transcribed spacer (ITS) regions (ITS-1 to ITS-5) of ribosomal DNA (rDNA) gene clusters are used. Primers routinely used for the amplification of ITS regions of ribosomal DNA are ITS-1 and ITS-4 [16].

View Full Size

The phylogenetic tree of Aspergillus fumigatus 3T-EGY isolated from soil

Citation: Acta Chromatographica Acta Chromatographica 30, 4; 10.1556/1326.2017.00329

• Download Figure
• Download figure as PowerPoint slide

In vitro Antimicrobial Activity of the Fungal Extract and Resulting Fractions (1–13) from VLC Column

The in vitro antimicrobial activity of the soil inhabiting fungus extract was evaluated against four pathogenic microbial strains, i.e., S. aureus, Pseudomonas aeruginosa, C. albicans, and A. niger. The results revealed that the extract showed strong activity against P. aeruginosa and C. albicans with equal inhibition zones of 15 mm, and it was also showed a moderate activity against S. aureus and A. niger with inhibition zones of 10 and 9 mm, respectively. Penicillin G was used as positive control at concentration of 100 μg/disc with inhibition zones (S. aureus, 27 mm; P. aeruginosa, 20 mm; C. albicans, 25 mm; and A. niger, 0 mm) (Table 1). On the other hand, the resulting fractions (1–13) from the VLC column of the ethyl acetate extract were subjected to in vitro antimicrobial screening. Fractions 3, 4, and 5 exhibited the highest antimicrobial activity against all test microbes with inhibition zones were ranged from 8.0 to 18.5 mm. Moreover, fractions 6 and 8 showed a moderate activity with inhibition zones were ranged from 8.0 to 18.5 mm. Furthermore, fraction 7 showed a weak activity against only two test microbes, P. aeruginosa (6.5 mm) and C. albicans (6 mm). In addition, there is no any activity recorded with fractions 1, 2, 9, 10, 11, 12, and 13 (Table 2).

Reviewing the literature, it was revealed that the endophytic isolate A. fumigatus R7 exhibited strong in vitro antibacterial activity against Gram+ B. subtilis (16 mm) and S. aureus (15 mm), and Gram− bacteria P. aeruginosa (19 mm) and E. coli (16 mm), and there is no any antifungal activity against A. niger, A. flavus, and C. albicans [17]. Accordingly, our results are in agreement with the finding of previous studies. Also, the crude extract of A. fumigatus BTMF9 exhibited in vitro antimicrobial activity against Gram-positive bacteria B. circulans [18].

Structure Elucidation

The promising resulting fractions from VLC column which underwent further purification upon Sephadex LH-20 column to afford eight pure isolates, these compounds were identified on the basis of their one-dimensional (1D-) and two-dimensional nuclear magnetic resonance (2D-NMR) [¹H-, ¹³C-NMR, ¹H-¹H COSY, and ¹H-¹³C HMBC analyses] (Figure 3).

View Full Size

Chemical structures of the isolated compounds from Aspergillus fumigatus 3T-EGY

Citation: Acta Chromatographica Acta Chromatographica 30, 4; 10.1556/1326.2017.00329

• Download Figure
• Download figure as PowerPoint slide

Compound 1 was isolated as light yellow wax, infrared (IR): λ_max (cm⁻¹): 722, 787, 1075, 1170, 1225, 1380, 1470, 1550, 1682 (carbonyl group), 1730, 2975 (CH-aliphatic), and 3475 (hydroxyl group). ¹H-NMR (300 MHz, DMSO-d₆) spectrum showed a broad singlet signal observed at δ_H 0.78 ppm which indicated aliphatic methyl group. A large singlet appeared at δ_C 1.33 ppm indicative for thirty protons of fifteen consecutive methylene groups. A broad singlet signal appeared at δ_H 2.46 ppm (2H, br s, H-2) of methylene group vicinal to carboxyl group. ¹³C-NMR (75 MHz, DMSO-d₆) spectra showed peaks at δ_C 175.01 ppm (C-1) indicative to carbonyl group of carboxylic acid and at δ_C 39.33 ppm (C-2) indicative to oxy methylene group. The consecutive methylenes were detected at δ_C 25.02 (C-3), 29.17–29.67 (C-4 & C-15), 34.15 (C-16), and 22.65 (C-17); the last free methyl group appeared at δ_C 14.31 (C-18) ppm. All peaks in the ¹H- and ¹³C-NMR spectrum exist in aliphatic region, and this is an indication for aliphatic nature of compound 1. According to previous data and via comparison with physical and spectral data from the literature [19–21], compound 1 was identified as stearic acid.

Compound 2 was obtained as a light yellow wax; the IR spectrum showed a broad band at 3410.26 cm⁻¹ and 1716.70 cm⁻¹, indicating the presence of OH group and a carbonyl (C=O) group, and also showed peaks at 2929.97 cm⁻¹, 1458.23 cm⁻¹, and 1408.08 cm⁻¹ indicating the presence of aliphatic bonds. The ¹H-NMR spectrum showed a characteristic signal at δ_H 0.81 ppm (3H, s, Me-18) for methyl group and multiplets at δ_C 1.33–1.61 ppm (methylene hump) for 20 aliphatic protons, and at δ_H 2.13 ppm (2H, t, J = 7.2 Hz, H-2), δ_H 2.46 ppm (4H, H-8, and H-17), and δ_H 2.22 ppm (2H, t, J = 7.2 Hz, H-14), it also showed broad multiple peaks at δ_H 4.99–5.29 ppm for olefinic protons. Furthermore, ¹³C-NMR spectrum showed a peak at δ_C 170 ppm indicating the presence of carbonyl (–C=O) carbon and peaks at δ_C 130.22 and 128.27 ppm for four olefinic carbons. All the previous data coincide with the spectral data of α-linolenic acid which was previously isolated from Rhodiola rosea [22, 23]. Therefore, compound 2 was identified as α-linolenic acid.

Compound 3 was obtained as orange crystal (m.p. 208–210 °C; R_f upon PC in 15% AcOH (0.05) & BAW (0.87) and upon TLC in CH₂Cl₂–MeOH, 9:1 (0.76)). ¹H-NMR spectrum showed signals in aromatic region at δ_H 6.75 ppm (1H, br s, H-7), δ_H 7.06 ppm (1H, br s, H-2), δ_H 7.36 ppm (1H, d, J = 2.5 Hz, H-5), and δ_H 7.66 ppm ( 1H, d, J = 2.5 Hz, H-4), it also showed two singlets at δ_H 2.46 ppm (3H, s, Me) and δ_H 3.84 ppm (3H, s, O-Me), and a characteristic signal at δ_H 13.29 ppm for hydroxyl groups. These data agreed with ¹³C-NMR spectra which showed sixteen carbons; among them, fourteen carbons appeared in the aromatic region and two carbons showed signals at δ_C 21.8 (Me) and δ_C 56.7 ppm (OMe). The above mentioned spectral data agree with that reported in literature for physcion from genus Aspergillus [24, 25], lichen Xanthoria [26], and higher plant species [27]. Moreover, physcion has been widely isolated and characterized from both terrestrial and marine sources [24, 28]. Therefore, compound 3 was identified as physcion (1,8-Dihydroxy-3-methoxy-6-methylanthraquinone or Emodin-3-methyl ether).

Compound 4 was obtained as very light yellow oil, dissolved in most organic solvents but insoluble in water (R_f 0.58 upon TLC [n-hexane–CH₂Cl₂; 8:2, v/v], 0.66 [n-hexane–ethyl acetate; 8.5:1.5, v/v]). It gave purple color with concentrated H₂SO₄. The IR spectrum showed a characteristic carbonyl band at 1655 cm⁻¹, aromatic (Ar–C–H) at 3050 cm⁻¹, aliphatic (–C–H) band at 2932 cm⁻¹, strong band for etheric bond (–C–O) at 1021 cm⁻¹, and methyl vibration band from 1410 to 1319 cm⁻¹. ¹H-NMR (300 MHz, DMSO-d₆): δ_H 7.67 (2H, dd, J = 6 Hz, 2.7 Hz, H-3, H-6), δ_H 7.59 (2H, dd, J = 6 Hz, 2.7 Hz, H-4, H-5), δ_H 4.12 (4H, m, H-1′), δ_H 1.60 (2H, m, H-2′), δ_H 1.21–1.33 (12H, m, H-3′-H-4′, H-5′), δ_H 0.88 (6H, t, J = 5.7 Hz, H-6′), δ_H 1.49 (4H, m, H-7′), δ_H 0.80 (6H, t, J = 5.1 Hz, H-8′).¹³C-NMR (75 MHz, DMSO-d₆): δ_C 166.7 (–C=O), δ_C 131.8 (C-1, C-2), δ_C 131.1 (C-3, C-6), δ_C 129.3 (C-4, C-5), δ_C 67.2 (C-1′), δ_C 38.2 (C-2′), δ_C 31.4 (C-3′), δ_C 28.8 (C-4′), δ_C 22.4 (C-5′), δ_C 10.6 (C-6′), δ_C 23.3 (C-7′), and δ_C 13.7 (C-8′), on the basis of its spectral data compound 4 was identified as di-(2-ethylhexyl) phthalate [29, 30].

Compound 5 was obtained as fine powder (R_f upon PC in 15% AcOH [0.81]). It showed a characteristic violet spot on PC, which indicated its phenolic nature. It showed a characteristic spectral data of poly-aromatic nucleus compounds. ¹³C-NMR spectrum showed presence of 31 carbon atoms. Two quinone carbonyl groups are deduced from two carbon signals appeared at δ_C 189.0 and 184.7 ppm. Aromatic carbons showed numerous signals at δ_C 103.46–144.94 ppm, which proved poly-aromatic ring structures, supported by ¹H-NMR spectral data at δ_H 6.96 and 6.61 ppm. Four methoxy groups attached to aromatic ring showed a characteristic signals at δ_C 62.60, 65.40, 57.30, and 55.9 ppm in ¹³C-NMR spectrum and four singlets at δ_H 3.88, 3.76, 3.67, and 3.63 ppm in ¹H-NMR spectrum. Moreover, the presence of OH signal at δ_H 12.94 ppm indicated presence of phenolic hydroxyl group. Also, the carbon signal appeared at δ_C 168.09 ppm suggested the presence of unsaturated lactone structure of methylated isocoumarine moiety. Four methine (–CH–) groups showed characteristic signals at δ_C 120.6, 108.5, 107.2, and 103.4 ppm. Two methylene groups appeared at δ_C 21.83 & 28.94 ppm and δ_C 2.7–2.8 & 2.4–2.5 ppm in ¹H-NMR spectrum. Furthermore, the carboxylic carbon attached to aromatic ring gave a signal at 173.5 ppm in ¹³C-NMR spectrum. These spectral data were compared to that of polyketide compounds, i.e., griseorhodin A, collinone, precollinone, pradimicine lactone, polyketide KS-619-1, and anthraquinone compounds; it showed high similarities to these compounds [31]. Therefore, compound 5 could be identified as 2,4,5,17-tetramethoxy pradimicin lactone.

Compound 6 was obtained as orange powder (R_f upon PC in 15% AcOH [0.14]). Chemical and physical data suggested that compound 6 is coumarin glycoside. The chemical structure of the compound was interpreted via ¹H-NMR analysis. It showed three aromatic singlet signals at δ_H 7.38, 7.06, and 6.66 ppm attributed to H-4, H-6, and H-8, respectively. It also showed singlet at δ_H 13.62 ppm characteristic to aromatic hydroxyl proton. The anomeric proton appears as doublet at δ_H 4.13 ppm (d, J = 5.7 Hz, H-1 Rha). It showed also a characteristic rhamnose methyl at δ_C 1.21 ppm. Therefore, compound 6 could be identified as 3,5-dihydroxy-7-O-α-rhamnopyranoyl-2H-chromen-2-one [32].

Compound 7 was obtained as pale yellow fine crystal (m.p. 264–266; R_f upon PC in 15% AcOH [0.75]). It showed a characteristic yellow spot on PC. In the ¹H-NMR spectrum two meta coupled aromatic protons at δ_H 8.21 ppm (d) and 9.10 ppm (brs) were appeared in addition to three aromatic protons at δ_H 7.42, 7.63, and 7.80 ppm, which indicate the aromatic nature of the compound (Table 3). ¹³C-NMR spectrum showed two quinone (–C=O) groups at δ_C 187.1 and 197.1 ppm, in addition to carboxylic group at δ_C 166.7 and acetate group signal at δ_C 170.7 ppm. EtO− group was observed at δ_H 0.80 ppm (d, J = 7.5 Hz) and δ_H 4.36 (d, J = 6.6 Hz). Moreover, long-range correlation from δ_H 4.36 to 170.70 was observed. Three anomeric carbons were observed at ¹³C-NMR spectrum at δ_C 94.4, 92.6, and 91.4 ppm indicating the glycosidic nature of the compound. The oxymethine and methylene signals appeared between δ_H 3.0–5.45 ppm suggested the presence of glycosidic side chain attached to carbon-5 through O-linkage indicated by a characteristic signal at δ_C 128.5 in ¹³C-NMR and HMBC spectrums. Also, ¹H-NMR revealed many overlapping methyl and methylene signals in the up field region at δ_H 2.6–0.80 ppm and at δ_C 94.4–43.6 ppm, the two signals at δ_C 43.6 and 44.6 indicating the presence of two carbons attached to nitrogen atom. Complete assignments and connectivities of the compound were determined from H-H COSY, HMQC (Heteronuclear Multiple–Quantum Correlation), and HMBC spectra. By comparing ¹H- and ¹³C-NMR data with literature, it was shown that compound 7 is quinone connected to side chain at C-5 of three sugar moieties, viz., rhodosamine, 2-deoxy-d-glucose, and cinerulose B. Three anomeric proton signals were assigned at δ_H 5.45 ppm (rhodosamine), 4.92 ppm (deoxy glucose), and 5.15 ppm (cinerulose), in the ¹H-NMR spectrum through their direct one bond coupling in the HMQC spectrum with their own anomeric carbon signals at δ_C 94.4, 92.6, and 91.4 ppm, respectively. The interglycosidic and sugar aglycone linkages were deduced from the long-range three-bond HMBC correlations. The HMBC exhibited correlations between H-1′ [δ_H 5.45 (rhodosamine)] and C-5 [(δ_C 128.4) aglycone], H-1″ [(δ_H 4.92) deoxy glucose] and C-4′ [(δ_C 72.06) rhodosamine], and H1″′ [(δ_H 5.15) cinerulose] and C-4″ [(δ_C 75.11) deoxy glucose (Table 3). All ¹H- and ¹³C-resonances were assigned with the aid of HMQC and HMBC correlation peaks and comparison with the corresponding data of structurally related compounds [33]. Accordingly, compound 7 was identified as Juglanthraquinone A-5-O-rhodosamine-(4′→1″)-2-deoxy-d-glucose (4″→1″′)-cinerulose B.

Compound 8 was obtained as colorless amorphous solid (R_f upon PC in 15% AcOH [0.9]; UV [MeOH] 280 nm). Both ¹H and ¹³C spectra (DMSO-d₆) showed a characteristic signals for peptide nucleus. ¹³C-NMR spectrum showed nine signals for the amide carbonyl at δ_C 173.5, 173.3, 173.0, 170.4, 169.0, 166.4, 165.3, 156.3, and 156.1 ppm. Resonances present in the aromatic region of ¹³C-NMR at δ_C 136.8, 130.2, 128.8, 127.1, 128.3, and 129.1 ppm, supporting the presence of phenyl alanine moiety, and also resonances at δ_C 128.1, 130.7, 114.9, 156.1, 114.9, and 130.3 ppm, suggesting the presence of tyrosin moiety. These data are in agreement with ¹H-NMR spectra at δ_H 7.43–6.37 ppm. Moreover, butyric acid side chain was identified by methyl triplet at δ_H 0.87 and δ_C 14.0 ppm. Compound 8 was also recognized by presence of 3-amino-6-hydroxy-2-piperdone (Ahp) moiety (−C=O) at δ_C 169.0 and –CH₂–OH at δ_C 71.8 ppm. Therefore, compound 8 was identified as micropeptin via comparison its spectral and physical data with that of literature [34].

In vitro Antimicrobial Activity of Compound 7

Compound 7 showed a moderate in vitro antimicrobial activity against three pathogenic strains including S. aureus, P. aeruginosa, and C. albicans with inhibition zones values ranging from 9.0 to 10.66 mm, compared to neomycin as a positive control with inhibition zones values ranging from 14.0 to 19.0 mm (Table 4 and Figure 4).

View Full Size

In vitro antimicrobial activity of compound 7 against four pathogenic microbial test strains

Citation: Acta Chromatographica Acta Chromatographica 30, 4; 10.1556/1326.2017.00329

• Download Figure
• Download figure as PowerPoint slide

Literature review revealed that the in vitro antifungal activities of sixteen pure isolates from A. fumigatus were evaluated against B. cinerea, A. solani, A. alternata, C. gloeosporioides, F. solani, F. oxysporum f. sp. niveum, F. oxysporum f. sp. vasinfectum, and G. saubinettii, with minimum inhibitory concentration (MIC) values of 6.25–50 μg/mL [35]. Moreover, the antibacterial and antifungal activities of some isolates (asperfumoid, fumigaclavine C, fumigaclavine E, fumigaclavine G, 3b-hydroxy-5a,8a-epidioxy-ergosta-6,22-diene, monomethylsulochrin, ergosterol, fumitremorgin C, and helvolic acid) from A. fumigatus were evaluated against C. albicans, P. anaerobius, B. distasonis, E. coli, H. pylori, S. aureus, and others [36].