View More View Less
  • 1 Microbial Chemistry Department, Genetic Engineering and Biotechnology Division, National Research Center, El-Bohouth Street 33, Dokki-Giza 12622, Egypt
  • | 2 Medicinal Chemistry Department, Theodor Bilharz Research Institute, Kornaish El-Nile, Warrak El-Hadar 12411, Imbaba, Giza, Egypt
Open access

Eight compounds were isolated and identified from the soil-inhabiting fungus Aspergillus fumigatus 3T-EGY, namely, stearic acid (1), α-linolenic acid (2), physcion (3), di-(2-ethylhexyl) phthalate (4), 2,4,5,17-tetramethoxy pradimicin lactone (5), 3,5-dihydroxy-7-O-α-rhamnopyranoyl-2H-chromen-2-one (6), juglanthraquinone A-5-O-d-rhodosamine-(4′→1″)-2-deoxy-d-glucose (4″→1″′)-cinerulose B (7), and micropeptin (8). Their structures were determined on the basis of one-dimensional (1D-) and two-dimensional nuclear magnetic resonance (2D-NMR) [1H-, 13C-NMR, 1H-1H COSY (COrrelated SpectroscopY), and 1H-13C HMBC (Heteronuclear Multiple Bond Correlation) spectroscopy]. Compound 7 showed moderate in vitro antimicrobial activity against three pathogenic strains with inhibition zones values were ranged from 9.0 to 10.66 mm compared to neomycin as a positive control with inhibition zones values were ranged from 14.0 to 19.0 mm.

Abstract

Eight compounds were isolated and identified from the soil-inhabiting fungus Aspergillus fumigatus 3T-EGY, namely, stearic acid (1), α-linolenic acid (2), physcion (3), di-(2-ethylhexyl) phthalate (4), 2,4,5,17-tetramethoxy pradimicin lactone (5), 3,5-dihydroxy-7-O-α-rhamnopyranoyl-2H-chromen-2-one (6), juglanthraquinone A-5-O-d-rhodosamine-(4′→1″)-2-deoxy-d-glucose (4″→1″′)-cinerulose B (7), and micropeptin (8). Their structures were determined on the basis of one-dimensional (1D-) and two-dimensional nuclear magnetic resonance (2D-NMR) [1H-, 13C-NMR, 1H-1H COSY (COrrelated SpectroscopY), and 1H-13C HMBC (Heteronuclear Multiple Bond Correlation) spectroscopy]. Compound 7 showed moderate in vitro antimicrobial activity against three pathogenic strains with inhibition zones values were ranged from 9.0 to 10.66 mm compared to neomycin as a positive control with inhibition zones values were ranged from 14.0 to 19.0 mm.

Introduction

Microbial secondary metabolites have low molecular weight, and they are not important for their growth and reproduction as well as cell growth [1]. Berdy (2005) reported that the largest microbial group producing bioactive secondary metabolites was filamentous bacteria (actinomycetes), representing about 45% of the total compounds discovered followed by fungi (38%), but unicellular bacteria possess about 17% only [2]. Fungi are common in nature and are considered as a fruitful source of many antibiotics [3, 4]. Fungi related to as comycetes like Aspergillus, Penicillium, and Fusarium are the most famous producers of biologically active secondary metabolites in comparison to other fungal genera [2]. The majority of soil fungi were known for their potentiality to decompose organic matters and their contribution to nutrient cycling. In addition, they were considered as promising bioactive secondary metabolites producers as they have produced many bioactive compounds and chemically exceptional skeletal structures used as pharmaceuticals [5]. Recently, fungi have appeared as novel sources of antioxidants as a part of their bioactive secondary metabolites [6, 7]. Fungi are obviously a varied group having about 1.5 million species, which can give a broad diversity of metabolites such as alkaloids, benzoquinones, flavonoids, phenols, steroids, terpenoids, tetralones, and xanthones [8]. In addition to antioxidants, fungi exhibit various bioactivities and functions. Fungi found different applications in medicine industry and considered to be possible sources of new therapeutic agents. Therefore, the aims of the current study were to isolate, identify the fungus, and evaluate the in vitro antimicrobial activity of different vacuum liquid chromatography (VLC) fractions from extract of the fungus Aspergillus fumigatus 3T-EGY, grown on rice medium. The chromatographic isolation and identification of its bioactive secondary metabolites were also studied.

Experimental

General Experimental Procedures

Melting point (uncorrected) was determined on an electrothermal apparatus. 1H-, 13C-NMR, 1H-1H COSY (COrrelated SpectroscopY), and 1H-13C HMBC (Heteronuclear Multiple Bond Correlation) spectra were obtained using a pulse sequence supplied from Varian Mecauy 300 MHz spectrometer (1H, 300 MHz and 13C, 75 MHz, in deuterated dimethylsulphoxide [DMSO-d6]). Chemical shifts (δ) were given in values (ppm) relative to trimethylsilane (TMS) as an internal reference and coupling constant (J) in Hertz. All solvents and reagents used were of analytical grade. Sephadex LH-20 (25–100 μm, Pharmacia Fine Chemicals Inc., Uppsala, Sweden). Paper chromatography (PC) was carried out on Whatman No. 1 paper sheets (57 cm × 46 cm; Maidstone, England) (S1, n-BuOH–AcOH–H2O, 4:1:5 upper layer; S2, H2O–AcOH, 85:15). Spots were visualized under Vilber Lourmat UV lamp (VL-6LC France) at 254 and 365 nm and then sprayed with methanolic 1% FeCl3 and/or 5% AlCl3.

Media

The following media were used in the study: nutrient agar medium (DSMZ1) (beef extract, 3; peptone, 10; agar, 18–20; distilled water, 1000 mL; pH 7), Czapek-Dox (CD) agar medium (DSMZ 130) (sucrose, 30; NaNO3, 3; MgSO4⋅7H2O, 0.5; FeSO4⋅7H2O, 0.01; K2HPO4, 1; KCl, 0.5; distilled water, 1000 mL; agar, 18–20).

Isolation of Terrestrial Fungi

Soil samples were collected in the surrounding of Mansoura Governorate, Egypt during May 2012; soil was taken at 10 cm depth. Samples were sieved and air dried for 3–5 days at 28 °C. After drying, samples were kept at 10 °C until used. Fungal strains were isolated from soil samples. Enumeration of the microbes present in the soil was done by serial dilution-agar plating method. Serial dilution of soil suspension was prepared up to 10−6 dilution. Then, 0.1 mL of suspension from dilutions 10−3 to 10−6 was transferred to the petri dishes containing CD agar medium at 28 ± 2 °C for 6–8 days, and growth was observed after 2 days. The fungi isolated on culture medium from soil were purified by spore suspension and streak method. The cultures were routinely transferred (every 6–8 days) onto fresh CD agar plates by streaking. Before fungal cultures were used for inoculation of liquid growth medium, the fungus was subjected to three transfers on CD agar plates by the direct agar transfer method [9].

Scale up Fermentation, and Extraction

Scale-up fermentation has been maintained using 15 Erlenmeyer flasks (1 L volume); each contains 100 g rice and 100 mL distilled water, sterilized at 121 °C (15 lb) for 20 min. Each flask was inoculated with spore suspension from 1 slant (10 days old). After incubation at 30 °C for 15 days, the medium was extracted with ethyl acetate several times till exhaustion. A reddish brown extract was produced (≅20 g).

Fungal Identification

Fungal isolate (3T) was identified by DNA isolation, amplification by polymerase chain reaction (PCR), and sequencing of the internal transcribed spacer (ITS) region. The primers ITS2 (GCTGCGTTCTTCATCGATGC) and ITS3 (GCATCGATGAAGAACGCAGC) were used for PCR amplification while ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were taken for sequencing. Candida sp. was tested as control. The sequence data were submitted to GenBank. The fungal strain (3T) culture was reserved in the Microbial Chemistry Department Culture Collection of Microorganisms.

In vitro Antimicrobial Activity

Disc agar plate method has been established to evaluate the antimicrobial activities of different fractions as well as compound 7 that dissolved in methanol (MeOH) [10]. Four different test microbes, Staphylococcus aureus, Escherichia coli, Candida albicans, and Aspergillus niger, were selected to evaluate the antimicrobial activities as representatives of Gram+ bacteria, Gram− bacteria, yeast, and fungal groups, respectively. The bacterial and yeast test microbes were grown on a nutrient agar medium. On the other hand, the fungal test microbe was cultivated on Czapek-Dox medium. The culture of each test microbe was diluted by distilled water (sterilized) to 107 to 108 colony forming units (CFUs)/mL, and then 1 mL of each was used to inoculate 1 L Erlenmeyer flask containing 250 mL of solidified agar media. These media were put onto previously sterilized Petri dishes (10 cm diameter having 25 mL of solidified media). Filter paper discs (5 mm Ø, Whatman No. 1 filter paper) loaded with 0.2 mg of each extract and 100 μg of pure sample. The discs were dried at room temperature under sterilized conditions. The paper discs were placed on agar plates seeded with test microbes and incubated for 24 h, at the appropriate temperature of each test organism. Antimicrobial activities were recorded as the diameter of the clear zones (including the disc itself) that appeared around the discs [11].

Isolation and Purification of Secondary Metabolites

The ethyl acetate (EtOAc) extract was evaporated to dryness to give a brownish mass (20 g) and then underwent fractionation using VLC on silica gel 60 using solvents in a gradient of increasing polarity; n-hexane–ethyl acetate, dichloromethane–methanol (CH2Cl2–MeOH), and 100% acetone step gradient elution to afford thirteen fractions eluted from the VLC as follows: fractions 1–6 were eluted by n-hexane–EtOAc; 100:0–80:20–60:40–40:60–20:80–80:20–0:100 (%v/v), respectively, for the fractions 1–6; also, fractions 7–12 were eluted by CH2Cl2–MeOH; 100:0–80:20–60:40–40:60–20:80–80:20–0:100 (%v/v), respectively, for the fractions 7–12, finally fraction (13) was eluted by 100% acetone. The in vitro antimicrobial activity of these fractions was evaluated; among them, the most promising fraction was undergoing further chromatographic isolation and purification via size exclusion chromatography using Sephadex LH-20 column (30 × 2 cm) eluted with 100% MeOH to afford eight pure compounds (Figure 1). In details, fraction 3 (1.5 g) was subjected to Sephadex LH-20 eluted with gradient mix elution system, CH2Cl2–MeOH till 100% MeOH; each sub-fraction was eluted as a single band to afford four compounds 1–4. On the other hand, fraction 4 (1.25 g) was subjected to Sephadex LH-20 column eluted with 100% MeOH to afford two compounds 5 and 6. Also, fraction 5 (1 g) was subjected to Sephadex LH-20 column eluted with 100% MeOH to afford compound 7. Finally, fraction 6 (0.75 g) was subjected to Sephadex LH-20 column eluted with 100% MeOH to afford compound 8.

Figure 1.
Figure 1.

Flow chart representing the cultivation, extraction, and purification of bioactive metabolites from fungus Aspergillus fumigatus 3T-EGY

Citation: Acta Chromatographica Acta Chromatographica 30, 4; 10.1556/1326.2017.00329

Results and Discussions

Identification of the Fungal Isolate 3T-EGY

Basic Local Alignment Search Tool (BLAST) search for the fungus isolate revealed 99% similarity to A. fumigatus. The phylogenic tree of this fungal isolate was also constructed (Figure 2). Based on the above identification techniques, our local soil fungal isolate was identified as A. fumigatus 3T-EGY with the GeneBank accession number KP140961 (http://www.ncbi.nlm.nih.gov/nuccore/KP140961.1). Conventional fungal identification protocols including morphological characteristics, growth on different media, and type of spores as well as biochemical behavior such as pigment production, etc. have been commonly applied, and several new species still now are identified according to this methods [12]. However, these methods take long time, have low sensitivity, difficult to control, and non-specific [13, 14]. Targeting specific regions within the ribosomal RNA gene clusters using universal primers through PCR amplification is another optional method for the fungal identification to the species level and also for analyzing fungal diversity [15]. In this context, internal transcribed spacer (ITS) regions (ITS-1 to ITS-5) of ribosomal DNA (rDNA) gene clusters are used. Primers routinely used for the amplification of ITS regions of ribosomal DNA are ITS-1 and ITS-4 [16].

Figure 2.
Figure 2.

The phylogenetic tree of Aspergillus fumigatus 3T-EGY isolated from soil

Citation: Acta Chromatographica Acta Chromatographica 30, 4; 10.1556/1326.2017.00329

In vitro Antimicrobial Activity of the Fungal Extract and Resulting Fractions (1–13) from VLC Column

The in vitro antimicrobial activity of the soil inhabiting fungus extract was evaluated against four pathogenic microbial strains, i.e., S. aureus, Pseudomonas aeruginosa, C. albicans, and A. niger. The results revealed that the extract showed strong activity against P. aeruginosa and C. albicans with equal inhibition zones of 15 mm, and it was also showed a moderate activity against S. aureus and A. niger with inhibition zones of 10 and 9 mm, respectively. Penicillin G was used as positive control at concentration of 100 μg/disc with inhibition zones (S. aureus, 27 mm; P. aeruginosa, 20 mm; C. albicans, 25 mm; and A. niger, 0 mm) (Table 1). On the other hand, the resulting fractions (1–13) from the VLC column of the ethyl acetate extract were subjected to in vitro antimicrobial screening. Fractions 3, 4, and 5 exhibited the highest antimicrobial activity against all test microbes with inhibition zones were ranged from 8.0 to 18.5 mm. Moreover, fractions 6 and 8 showed a moderate activity with inhibition zones were ranged from 8.0 to 18.5 mm. Furthermore, fraction 7 showed a weak activity against only two test microbes, P. aeruginosa (6.5 mm) and C. albicans (6 mm). In addition, there is no any activity recorded with fractions 1, 2, 9, 10, 11, 12, and 13 (Table 2).

Table 1.

In vitro antimicrobial activity of the ethyl acetate extract of Aspergillus fumigatus 3T-EGY grown on rice medium

Test microbeMicrobial groupClear zone (ϕ mm)a
3T-EGYPenicillin Gb
S. aureusG+ bacteria1027
P. aeruginosaG− bacteria1520
C. albicansYeast1525
A. nigerFungus90

Inhibition zones diameter (mm).

Penicillin G was used as a positive control (100 μg/disc).

Table 2.

In vitro antimicrobial activity of the different fractions from VLC column of ethyl acetate extract of Aspergillus fumigatus 3T-EGY grown on rice medium

Fraction no.Clear zone (ϕ mm)a
S. aureusP. aeruginosaC. albicansA. niger
10000
20000
311.50 ± 0.70b14.50 ± 0.6513.50 ± 0.758.50 ± 0.80
414.0 ± 1.4116.0 ± 0.7518.50 ± 2.129.50 ± 0.90
511.50 ± 1.2110.0 ± 2.159.50 ± 1.308.0 ± 1.23
66.50 ± 0.726.50 ± 0.846.0 ± 0.09.0 ± 1.43
70.0–0.08.50 ± 0.796.0 ± 0.00.0–0.0
86.50 ± 0.9206.50 ± 1.4512.0 ± 1.25
90000
100000
110000
120000
130000
Penicillin Gc2720250
Streptomycind132100

Inhibition zones diameter (mm).

Mean ± SD, n = 3.

Penicillin G was used as a positive control (100 μg/disc).

Streptomycin was used as a positive control (100 μg/disc).

Reviewing the literature, it was revealed that the endophytic isolate A. fumigatus R7 exhibited strong in vitro antibacterial activity against Gram+ B. subtilis (16 mm) and S. aureus (15 mm), and Gram− bacteria P. aeruginosa (19 mm) and E. coli (16 mm), and there is no any antifungal activity against A. niger, A. flavus, and C. albicans [17]. Accordingly, our results are in agreement with the finding of previous studies. Also, the crude extract of A. fumigatus BTMF9 exhibited in vitro antimicrobial activity against Gram-positive bacteria B. circulans [18].

Structure Elucidation

The promising resulting fractions from VLC column which underwent further purification upon Sephadex LH-20 column to afford eight pure isolates, these compounds were identified on the basis of their one-dimensional (1D-) and two-dimensional nuclear magnetic resonance (2D-NMR) [1H-, 13C-NMR, 1H-1H COSY, and 1H-13C HMBC analyses] (Figure 3).

Figure 3.
Figure 3.

Chemical structures of the isolated compounds from Aspergillus fumigatus 3T-EGY

Citation: Acta Chromatographica Acta Chromatographica 30, 4; 10.1556/1326.2017.00329

Compound 1 was isolated as light yellow wax, infrared (IR): λmax (cm−1): 722, 787, 1075, 1170, 1225, 1380, 1470, 1550, 1682 (carbonyl group), 1730, 2975 (CH-aliphatic), and 3475 (hydroxyl group). 1H-NMR (300 MHz, DMSO-d6) spectrum showed a broad singlet signal observed at δH 0.78 ppm which indicated aliphatic methyl group. A large singlet appeared at δC 1.33 ppm indicative for thirty protons of fifteen consecutive methylene groups. A broad singlet signal appeared at δH 2.46 ppm (2H, br s, H-2) of methylene group vicinal to carboxyl group. 13C-NMR (75 MHz, DMSO-d6) spectra showed peaks at δC 175.01 ppm (C-1) indicative to carbonyl group of carboxylic acid and at δC 39.33 ppm (C-2) indicative to oxy methylene group. The consecutive methylenes were detected at δC 25.02 (C-3), 29.17–29.67 (C-4 & C-15), 34.15 (C-16), and 22.65 (C-17); the last free methyl group appeared at δC 14.31 (C-18) ppm. All peaks in the 1H- and 13C-NMR spectrum exist in aliphatic region, and this is an indication for aliphatic nature of compound 1. According to previous data and via comparison with physical and spectral data from the literature [1921], compound 1 was identified as stearic acid.

Compound 2 was obtained as a light yellow wax; the IR spectrum showed a broad band at 3410.26 cm−1 and 1716.70 cm−1, indicating the presence of OH group and a carbonyl (C=O) group, and also showed peaks at 2929.97 cm−1, 1458.23 cm−1, and 1408.08 cm−1 indicating the presence of aliphatic bonds. The 1H-NMR spectrum showed a characteristic signal at δH 0.81 ppm (3H, s, Me-18) for methyl group and multiplets at δC 1.33–1.61 ppm (methylene hump) for 20 aliphatic protons, and at δH 2.13 ppm (2H, t, J = 7.2 Hz, H-2), δH 2.46 ppm (4H, H-8, and H-17), and δH 2.22 ppm (2H, t, J = 7.2 Hz, H-14), it also showed broad multiple peaks at δH 4.99–5.29 ppm for olefinic protons. Furthermore, 13C-NMR spectrum showed a peak at δC 170 ppm indicating the presence of carbonyl (–C=O) carbon and peaks at δC 130.22 and 128.27 ppm for four olefinic carbons. All the previous data coincide with the spectral data of α-linolenic acid which was previously isolated from Rhodiola rosea [22, 23]. Therefore, compound 2 was identified as α-linolenic acid.

Compound 3 was obtained as orange crystal (m.p. 208–210 °C; Rf upon PC in 15% AcOH (0.05) & BAW (0.87) and upon TLC in CH2Cl2–MeOH, 9:1 (0.76)). 1H-NMR spectrum showed signals in aromatic region at δH 6.75 ppm (1H, br s, H-7), δH 7.06 ppm (1H, br s, H-2), δH 7.36 ppm (1H, d, J = 2.5 Hz, H-5), and δH 7.66 ppm ( 1H, d, J = 2.5 Hz, H-4), it also showed two singlets at δH 2.46 ppm (3H, s, Me) and δH 3.84 ppm (3H, s, O-Me), and a characteristic signal at δH 13.29 ppm for hydroxyl groups. These data agreed with 13C-NMR spectra which showed sixteen carbons; among them, fourteen carbons appeared in the aromatic region and two carbons showed signals at δC 21.8 (Me) and δC 56.7 ppm (OMe). The above mentioned spectral data agree with that reported in literature for physcion from genus Aspergillus [24, 25], lichen Xanthoria [26], and higher plant species [27]. Moreover, physcion has been widely isolated and characterized from both terrestrial and marine sources [24, 28]. Therefore, compound 3 was identified as physcion (1,8-Dihydroxy-3-methoxy-6-methylanthraquinone or Emodin-3-methyl ether).

Compound 4 was obtained as very light yellow oil, dissolved in most organic solvents but insoluble in water (Rf 0.58 upon TLC [n-hexane–CH2Cl2; 8:2, v/v], 0.66 [n-hexane–ethyl acetate; 8.5:1.5, v/v]). It gave purple color with concentrated H2SO4. The IR spectrum showed a characteristic carbonyl band at 1655 cm−1, aromatic (Ar–C–H) at 3050 cm−1, aliphatic (–C–H) band at 2932 cm−1, strong band for etheric bond (–C–O) at 1021 cm−1, and methyl vibration band from 1410 to 1319 cm−1. 1H-NMR (300 MHz, DMSO-d6): δH 7.67 (2H, dd, J = 6 Hz, 2.7 Hz, H-3, H-6), δH 7.59 (2H, dd, J = 6 Hz, 2.7 Hz, H-4, H-5), δH 4.12 (4H, m, H-1′), δH 1.60 (2H, m, H-2′), δH 1.21–1.33 (12H, m, H-3′-H-4′, H-5′), δH 0.88 (6H, t, J = 5.7 Hz, H-6′), δH 1.49 (4H, m, H-7′), δH 0.80 (6H, t, J = 5.1 Hz, H-8′).13C-NMR (75 MHz, DMSO-d6): δC 166.7 (–C=O), δC 131.8 (C-1, C-2), δC 131.1 (C-3, C-6), δC 129.3 (C-4, C-5), δC 67.2 (C-1′), δC 38.2 (C-2′), δC 31.4 (C-3′), δC 28.8 (C-4′), δC 22.4 (C-5′), δC 10.6 (C-6′), δC 23.3 (C-7′), and δC 13.7 (C-8′), on the basis of its spectral data compound 4 was identified as di-(2-ethylhexyl) phthalate [29, 30].

Compound 5 was obtained as fine powder (Rf upon PC in 15% AcOH [0.81]). It showed a characteristic violet spot on PC, which indicated its phenolic nature. It showed a characteristic spectral data of poly-aromatic nucleus compounds. 13C-NMR spectrum showed presence of 31 carbon atoms. Two quinone carbonyl groups are deduced from two carbon signals appeared at δC 189.0 and 184.7 ppm. Aromatic carbons showed numerous signals at δC 103.46–144.94 ppm, which proved poly-aromatic ring structures, supported by 1H-NMR spectral data at δH 6.96 and 6.61 ppm. Four methoxy groups attached to aromatic ring showed a characteristic signals at δC 62.60, 65.40, 57.30, and 55.9 ppm in 13C-NMR spectrum and four singlets at δH 3.88, 3.76, 3.67, and 3.63 ppm in 1H-NMR spectrum. Moreover, the presence of OH signal at δH 12.94 ppm indicated presence of phenolic hydroxyl group. Also, the carbon signal appeared at δC 168.09 ppm suggested the presence of unsaturated lactone structure of methylated isocoumarine moiety. Four methine (–CH–) groups showed characteristic signals at δC 120.6, 108.5, 107.2, and 103.4 ppm. Two methylene groups appeared at δC 21.83 & 28.94 ppm and δC 2.7–2.8 & 2.4–2.5 ppm in 1H-NMR spectrum. Furthermore, the carboxylic carbon attached to aromatic ring gave a signal at 173.5 ppm in 13C-NMR spectrum. These spectral data were compared to that of polyketide compounds, i.e., griseorhodin A, collinone, precollinone, pradimicine lactone, polyketide KS-619-1, and anthraquinone compounds; it showed high similarities to these compounds [31]. Therefore, compound 5 could be identified as 2,4,5,17-tetramethoxy pradimicin lactone.

Compound 6 was obtained as orange powder (Rf upon PC in 15% AcOH [0.14]). Chemical and physical data suggested that compound 6 is coumarin glycoside. The chemical structure of the compound was interpreted via 1H-NMR analysis. It showed three aromatic singlet signals at δH 7.38, 7.06, and 6.66 ppm attributed to H-4, H-6, and H-8, respectively. It also showed singlet at δH 13.62 ppm characteristic to aromatic hydroxyl proton. The anomeric proton appears as doublet at δH 4.13 ppm (d, J = 5.7 Hz, H-1 Rha). It showed also a characteristic rhamnose methyl at δC 1.21 ppm. Therefore, compound 6 could be identified as 3,5-dihydroxy-7-O-α-rhamnopyranoyl-2H-chromen-2-one [32].

Compound 7 was obtained as pale yellow fine crystal (m.p. 264–266; Rf upon PC in 15% AcOH [0.75]). It showed a characteristic yellow spot on PC. In the 1H-NMR spectrum two meta coupled aromatic protons at δH 8.21 ppm (d) and 9.10 ppm (brs) were appeared in addition to three aromatic protons at δH 7.42, 7.63, and 7.80 ppm, which indicate the aromatic nature of the compound (Table 3). 13C-NMR spectrum showed two quinone (–C=O) groups at δC 187.1 and 197.1 ppm, in addition to carboxylic group at δC 166.7 and acetate group signal at δC 170.7 ppm. EtO− group was observed at δH 0.80 ppm (d, J = 7.5 Hz) and δH 4.36 (d, J = 6.6 Hz). Moreover, long-range correlation from δH 4.36 to 170.70 was observed. Three anomeric carbons were observed at 13C-NMR spectrum at δC 94.4, 92.6, and 91.4 ppm indicating the glycosidic nature of the compound. The oxymethine and methylene signals appeared between δH 3.0–5.45 ppm suggested the presence of glycosidic side chain attached to carbon-5 through O-linkage indicated by a characteristic signal at δC 128.5 in 13C-NMR and HMBC spectrums. Also, 1H-NMR revealed many overlapping methyl and methylene signals in the up field region at δH 2.6–0.80 ppm and at δC 94.4–43.6 ppm, the two signals at δC 43.6 and 44.6 indicating the presence of two carbons attached to nitrogen atom. Complete assignments and connectivities of the compound were determined from H-H COSY, HMQC (Heteronuclear Multiple–Quantum Correlation), and HMBC spectra. By comparing 1H- and 13C-NMR data with literature, it was shown that compound 7 is quinone connected to side chain at C-5 of three sugar moieties, viz., rhodosamine, 2-deoxy-d-glucose, and cinerulose B. Three anomeric proton signals were assigned at δH 5.45 ppm (rhodosamine), 4.92 ppm (deoxy glucose), and 5.15 ppm (cinerulose), in the 1H-NMR spectrum through their direct one bond coupling in the HMQC spectrum with their own anomeric carbon signals at δC 94.4, 92.6, and 91.4 ppm, respectively. The interglycosidic and sugar aglycone linkages were deduced from the long-range three-bond HMBC correlations. The HMBC exhibited correlations between H-1′ [δH 5.45 (rhodosamine)] and C-5 [(δC 128.4) aglycone], H-1″ [(δH 4.92) deoxy glucose] and C-4′ [(δC 72.06) rhodosamine], and H1″′ [(δH 5.15) cinerulose] and C-4″ [(δC 75.11) deoxy glucose (Table 3). All 1H- and 13C-resonances were assigned with the aid of HMQC and HMBC correlation peaks and comparison with the corresponding data of structurally related compounds [33]. Accordingly, compound 7 was identified as Juglanthraquinone A-5-O-rhodosamine-(4′→1″)-2-deoxy-d-glucose (4″→1″′)-cinerulose B.

Table 3.

HMBC assignments, 1H (300 MHz) and 13C (75 MHz) NMR spectral data of compound 7 in DMSO-d6 (δ in ppm)

PositionδC ppmδH ppmHMBC
Aglycone
1128.54
2133.908.21 (d)
3134.08
4129.109.1 (brs)
4a130.40
5128.45
6127.807.42
77.62
8120.757.8
8a131.63
9187.14
9a133.58
10197.14
10a111.8
Sugar moieties
1′94.465.455, 3′
2′29.22.44′
3′57.41′, 5′
4′72.063.252′, 6′
5′65.863.553′
6′20.551.664′
3′-N(CH3)243.66/44.652.17
1″92.654.924′, 3″
2″24.651.94″
3″25.345″, 1″
4″75.113.172″, 6″
5″66.984.443″
6″22.21.9 (d, 6.6)4″
1″′91.425.154″, 3″′
2″′28.711.64″′
3″′33.852.411″′, 5″′
4″′4.12″′, 6″′
5″′68.394.35 (6.6)3″′
6″′14.231.20 (5.1)4″′
3-COOH166.79
EtOCO–170.70
–CH265.84.36 (d, J = 6.6 Hz)
–CH314.00.8 (d, J = 7.5 Hz)

Compound 8 was obtained as colorless amorphous solid (Rf upon PC in 15% AcOH [0.9]; UV [MeOH] 280 nm). Both 1H and 13C spectra (DMSO-d6) showed a characteristic signals for peptide nucleus. 13C-NMR spectrum showed nine signals for the amide carbonyl at δC 173.5, 173.3, 173.0, 170.4, 169.0, 166.4, 165.3, 156.3, and 156.1 ppm. Resonances present in the aromatic region of 13C-NMR at δC 136.8, 130.2, 128.8, 127.1, 128.3, and 129.1 ppm, supporting the presence of phenyl alanine moiety, and also resonances at δC 128.1, 130.7, 114.9, 156.1, 114.9, and 130.3 ppm, suggesting the presence of tyrosin moiety. These data are in agreement with 1H-NMR spectra at δH 7.43–6.37 ppm. Moreover, butyric acid side chain was identified by methyl triplet at δH 0.87 and δC 14.0 ppm. Compound 8 was also recognized by presence of 3-amino-6-hydroxy-2-piperdone (Ahp) moiety (−C=O) at δC 169.0 and –CH2–OH at δC 71.8 ppm. Therefore, compound 8 was identified as micropeptin via comparison its spectral and physical data with that of literature [34].

In vitro Antimicrobial Activity of Compound 7

Compound 7 showed a moderate in vitro antimicrobial activity against three pathogenic strains including S. aureus, P. aeruginosa, and C. albicans with inhibition zones values ranging from 9.0 to 10.66 mm, compared to neomycin as a positive control with inhibition zones values ranging from 14.0 to 19.0 mm (Table 4 and Figure 4).

Table 4.

In vitro antimicrobial activity of compound 7 (50 μg/disc) against four pathogenic microbial strains, compared to neomycin as a positive control

Test microbeClear zone (ϕ mm)a
Compound 7Neomycinc
S. aureus9.0 ± 1.0b14.0 ± 1.0
P. aeruginosa10.0 ± 1.017.3 ± 0.57
C. albicans10.66 ± 1.1519.0 ± 1.0
A. niger0–00–0

Inhibition zones diameter (mm).

Mean ± SD, n = 2.

Neomycin was used as a positive control (50 μg/disc).

Figure 4.
Figure 4.

In vitro antimicrobial activity of compound 7 against four pathogenic microbial test strains

Citation: Acta Chromatographica Acta Chromatographica 30, 4; 10.1556/1326.2017.00329

Literature review revealed that the in vitro antifungal activities of sixteen pure isolates from A. fumigatus were evaluated against B. cinerea, A. solani, A. alternata, C. gloeosporioides, F. solani, F. oxysporum f. sp. niveum, F. oxysporum f. sp. vasinfectum, and G. saubinettii, with minimum inhibitory concentration (MIC) values of 6.25–50 μg/mL [35]. Moreover, the antibacterial and antifungal activities of some isolates (asperfumoid, fumigaclavine C, fumigaclavine E, fumigaclavine G, 3b-hydroxy-5a,8a-epidioxy-ergosta-6,22-diene, monomethylsulochrin, ergosterol, fumitremorgin C, and helvolic acid) from A. fumigatus were evaluated against C. albicans, P. anaerobius, B. distasonis, E. coli, H. pylori, S. aureus, and others [36].

Conclusions

Fungi play an essential role in the production of several bioactive secondary metabolites. Fungal strain (3T) was isolated from the Egyptian local agricultural soil and was tested for its ability to produce bioactive metabolites by cultivating it on solid rice medium. The produced bioactive extract was fractionated using VLC (13 fraction), and the produced fractions were biologically evaluated by measuring their antimicrobial activities. The highly bioactive fractions (3–6) were further purified via using the Sephadex LH-20 column. One bioactive compound, Juglanthraquinone A-5-O-d-rhodosamine-(4′→1″)-2-deoxy-d-glucose (4″→1″′)-cinerulose B, and other seven compounds were elucidated and characterized.

Conflicts of Interest

The authors declare no conflict of interest.

Acknowledgments

This work was financially supported by the Commission of Research Projects—Theodor Bilharz Research Institute (No. 103A).

References

  • 1.

    Verpoorte R. Drug Dev. Today 1998, 3, 232.

  • 2.

    Berdy J. J. Antibiot. (Tokyo) 2005, 58, 1.

  • 3.

    Abad M. J. ; Ansuategu I. M.; Bermejio P. Arkivoc. 2007, 2, 116.

  • 4.

    Muhsin T. M. ; Al-Duboon A. A.; Khalaf K. T. Jordan J. Biol. Sci. 2011, 4, 205.

  • 5.

    Adrio J. ; Demain L.; Arnold L. Int. Microbiol. 2003, 6, 191.

  • 6.

    Rodrigues K. F. ; Costa G. L.; Carvalho M. P., Epifanio R. D. A. World J. Microbiol. Biotechnol. 2005, 21, 1617.

  • 7.

    Arora D. S. ; Chandra P.; Braz P. J. Microbiol. 2010, 41, 465.

  • 8.

    Archer D. B. Curr. Opin. Biotechnol. 2000, 11, 478.

  • 9.

    Abdel-Aziz M. S. ; Hezma A. M. Polym.-Plast. Technol. Eng. 2013, 52, 1503.

  • 10.

    Collins C. H. ; Lyne P. M. Microbiological Methods, 5th edition; Butterworth & Co. Pub. Ltd.: London, UK & Toronto, Canada, 1985.

  • 11.

    Abdel-Aziz M. S. ; Abou-El-Sherbini K. S.; Hamzawy E. M. A.; Amr M. H. A.; El-Dafrawy S. Appl. Biochem. Biotechnol. 2015, 176, 2225.

  • 12.

    Zhao G. Z. ; Liu X. Z.; Wu W. P. Fungal Diver. 2007, 26, 313.

  • 13.

    Raper K. B. ; Fennell D. I. The genus Aspergillus; Williams and Williams: Baltimore, Washington, 1965.

  • 14.

    Zhao J. ; Kong F.; Li R.; Wang X.; Wan Z.; Wang D. J. Clin. Microbiol. 2001, 39, 2261.

  • 15.

    Chen Y. C. J. D. ; Eisner M. M.; Kattar S. L.; Lafe R. K.; Bui U. J. Clin. Microbiol. 2001, 39, 4042.

  • 16.

    White N. A. ; Dehal P. K.; Duncan J. M.; Williams N. A.; Gartland J. S.; Palfreyman J. W.; Cooke D. E. L. Mycol. Res. 2001, 105, 447.

  • 17.

    Shaaban M. ; Nasr H.; Hassan A. Z.; Asker M. S. Rev. Latinoamer. Quím. 2013, 41, 50.

  • 18.

    Rekha M. K. R. ; Manzur A. P. P.; Sapna K.; Abraham M.; Preethi G. U.; Sarita G. B.; Elyas K. K. Curr. Res. Microbiol. Biotechnol. 2014, 2, 530.

    • Search Google Scholar
    • Export Citation
  • 19.

    Der Satyender K. Y. Pharm. Chem. 2013, 5, 59.

  • 20.

    Zhao J. L. ; Liu P.; Duan J. A.; Qian Y. F. China Tradit. Herb. Drugs 2013, 44, 1245.

  • 21.

    Bian-Na S. ; He-Ding S.; Hong-Xi W.; Li-Xiang Y.; Zhi-Qing C.; Ya D. Trop. J. Pharm. Res 2014, 13, 2071.

  • 22.

    Batchelor J. G. ; Cushley R. J.; Prestegard J. H. J. Org. Chem. 1974, 39, 1698.

  • 23.

    Van D. D. Phytochemical investigation of two Crassulaceae species: Rhodiola rosea L., the New “Herbal Stress Buster,” and Sedum dasyphyllum L. [dissertation]; University of Genève: Genève, 2009.

    • Search Google Scholar
    • Export Citation
  • 24.

    Anke H. ; Ilham K.; Zahner H.; Laatsch H. Arch. Microbiol. 1980, 126, 223230.

  • 25.

    Engstrom G. W. ; McDorman D. J.; Maroney M. J. J. Agric. Food Chem. 1980, 28, 1139.

  • 26.

    Manojlovic N. T. ; Solujic S.; Kristic L. J. J. Serb. Chem. Soc. 2000, 65, 555.

  • 27.

    Turner W. B. Fungal Metabolites; Academic Press: New York, 1971.

  • 28.

    Agarwal S. K. ; Singh S. S.; Verma S.; Kumar S. J. Ethnopharmacol. 2000, 72, 43.

  • 29.

    Dirar A. I. ; Mohamed M. A.; Ahmed W. J.; Mohammed M. S.; Khalid H. S.; Garelnabi E. A. E. J. Pharmacogn. Phytochem. 2014, 3, 38.

  • 30.

    El-Sayed O. H. ; Asker M. M. S.; Shash S. M.; Hamed S. R. Int. J. Chem. Tech. Res 2015, 8, 58.

  • 31.

    Yunt Z. S. Chemical investigation of Streptomyces albus heterologous expression strains and the biosynthesis of the aromatic polyketide griseorhodin [dissertation]; University of Bonn: İstanbul, Türkei, 2012.

    • Search Google Scholar
    • Export Citation
  • 32.

    Wang M. ; Zhoo J.; Hung R.; Li G.; Zeug X.; Li X. Nat. Prod. Res. 2016, 30, 1796.

  • 33.

    Shimasaka A. ; Hawakwa Y.; Nakagawa M.; Furihata K.; Seto H.; Otake N. J. Antibiot. 1987, 40, 116.

  • 34.

    Belofsky G. N. ; James B. G.; Donald T. W.; Patrick F. D. Tetrahedron Lett. 1998, 39, 5497.

  • 35.

    Li X. ; Zhang Q.; Zhang A.; Gao J. J. Agric. Food Chem. 2012, 60, 3424.

  • 36.

    Zhang H. ; Tang Y.; Ruan C.; Bai X. Rec. Nat. Prod. 2016, 10, 1.

  • 1.

    Verpoorte R. Drug Dev. Today 1998, 3, 232.

  • 2.

    Berdy J. J. Antibiot. (Tokyo) 2005, 58, 1.

  • 3.

    Abad M. J. ; Ansuategu I. M.; Bermejio P. Arkivoc. 2007, 2, 116.

  • 4.

    Muhsin T. M. ; Al-Duboon A. A.; Khalaf K. T. Jordan J. Biol. Sci. 2011, 4, 205.

  • 5.

    Adrio J. ; Demain L.; Arnold L. Int. Microbiol. 2003, 6, 191.

  • 6.

    Rodrigues K. F. ; Costa G. L.; Carvalho M. P., Epifanio R. D. A. World J. Microbiol. Biotechnol. 2005, 21, 1617.

  • 7.

    Arora D. S. ; Chandra P.; Braz P. J. Microbiol. 2010, 41, 465.

  • 8.

    Archer D. B. Curr. Opin. Biotechnol. 2000, 11, 478.

  • 9.

    Abdel-Aziz M. S. ; Hezma A. M. Polym.-Plast. Technol. Eng. 2013, 52, 1503.

  • 10.

    Collins C. H. ; Lyne P. M. Microbiological Methods, 5th edition; Butterworth & Co. Pub. Ltd.: London, UK & Toronto, Canada, 1985.

  • 11.

    Abdel-Aziz M. S. ; Abou-El-Sherbini K. S.; Hamzawy E. M. A.; Amr M. H. A.; El-Dafrawy S. Appl. Biochem. Biotechnol. 2015, 176, 2225.

  • 12.

    Zhao G. Z. ; Liu X. Z.; Wu W. P. Fungal Diver. 2007, 26, 313.

  • 13.

    Raper K. B. ; Fennell D. I. The genus Aspergillus; Williams and Williams: Baltimore, Washington, 1965.

  • 14.

    Zhao J. ; Kong F.; Li R.; Wang X.; Wan Z.; Wang D. J. Clin. Microbiol. 2001, 39, 2261.

  • 15.

    Chen Y. C. J. D. ; Eisner M. M.; Kattar S. L.; Lafe R. K.; Bui U. J. Clin. Microbiol. 2001, 39, 4042.

  • 16.

    White N. A. ; Dehal P. K.; Duncan J. M.; Williams N. A.; Gartland J. S.; Palfreyman J. W.; Cooke D. E. L. Mycol. Res. 2001, 105, 447.

  • 17.

    Shaaban M. ; Nasr H.; Hassan A. Z.; Asker M. S. Rev. Latinoamer. Quím. 2013, 41, 50.

  • 18.

    Rekha M. K. R. ; Manzur A. P. P.; Sapna K.; Abraham M.; Preethi G. U.; Sarita G. B.; Elyas K. K. Curr. Res. Microbiol. Biotechnol. 2014, 2, 530.

    • Search Google Scholar
    • Export Citation
  • 19.

    Der Satyender K. Y. Pharm. Chem. 2013, 5, 59.

  • 20.

    Zhao J. L. ; Liu P.; Duan J. A.; Qian Y. F. China Tradit. Herb. Drugs 2013, 44, 1245.

  • 21.

    Bian-Na S. ; He-Ding S.; Hong-Xi W.; Li-Xiang Y.; Zhi-Qing C.; Ya D. Trop. J. Pharm. Res 2014, 13, 2071.

  • 22.

    Batchelor J. G. ; Cushley R. J.; Prestegard J. H. J. Org. Chem. 1974, 39, 1698.

  • 23.

    Van D. D. Phytochemical investigation of two Crassulaceae species: Rhodiola rosea L., the New “Herbal Stress Buster,” and Sedum dasyphyllum L. [dissertation]; University of Genève: Genève, 2009.

    • Search Google Scholar
    • Export Citation
  • 24.

    Anke H. ; Ilham K.; Zahner H.; Laatsch H. Arch. Microbiol. 1980, 126, 223230.

  • 25.

    Engstrom G. W. ; McDorman D. J.; Maroney M. J. J. Agric. Food Chem. 1980, 28, 1139.

  • 26.

    Manojlovic N. T. ; Solujic S.; Kristic L. J. J. Serb. Chem. Soc. 2000, 65, 555.

  • 27.

    Turner W. B. Fungal Metabolites; Academic Press: New York, 1971.

  • 28.

    Agarwal S. K. ; Singh S. S.; Verma S.; Kumar S. J. Ethnopharmacol. 2000, 72, 43.

  • 29.

    Dirar A. I. ; Mohamed M. A.; Ahmed W. J.; Mohammed M. S.; Khalid H. S.; Garelnabi E. A. E. J. Pharmacogn. Phytochem. 2014, 3, 38.

  • 30.

    El-Sayed O. H. ; Asker M. M. S.; Shash S. M.; Hamed S. R. Int. J. Chem. Tech. Res 2015, 8, 58.

  • 31.

    Yunt Z. S. Chemical investigation of Streptomyces albus heterologous expression strains and the biosynthesis of the aromatic polyketide griseorhodin [dissertation]; University of Bonn: İstanbul, Türkei, 2012.

    • Search Google Scholar
    • Export Citation
  • 32.

    Wang M. ; Zhoo J.; Hung R.; Li G.; Zeug X.; Li X. Nat. Prod. Res. 2016, 30, 1796.

  • 33.

    Shimasaka A. ; Hawakwa Y.; Nakagawa M.; Furihata K.; Seto H.; Otake N. J. Antibiot. 1987, 40, 116.

  • 34.

    Belofsky G. N. ; James B. G.; Donald T. W.; Patrick F. D. Tetrahedron Lett. 1998, 39, 5497.

  • 35.

    Li X. ; Zhang Q.; Zhang A.; Gao J. J. Agric. Food Chem. 2012, 60, 3424.

  • 36.

    Zhang H. ; Tang Y.; Ruan C.; Bai X. Rec. Nat. Prod. 2016, 10, 1.

Monthly Content Usage

Abstract Views Full Text Views PDF Downloads
Jan 2021 0 16 8
Feb 2021 0 32 12
Mar 2021 0 22 17
Apr 2021 0 15 7
May 2021 0 11 10
Jun 2021 0 12 10
Jul 2021 0 0 0