Abstract
Flagellation is one of the major virulence factors of Campylobacter jejuni (C. jejuni), enabling bacterial cells to swarm in rather high viscous fluids. The aim of this study was to determine the impact of the surrounding viscosity on the expression of motility related genes of C. jejuni. Therefore, bacterial RNA was extracted from liquid cultures as well as from bacterial cells recovered from the edge and the center of a swarming halo from high viscous media. The expression pattern of selected flagellar and chemotaxis related genes was investigated by RT-PCR. Higher mRNA levels of class 1 and lower levels of class 2 and 3 flagellar assembly genes were detected in cells derived from the edge of a swarming halo than in cells from the center. This indicates different growth states at both locations within the swarming halo. Furthermore, higher mRNA levels for energy taxis and motor complex monomer genes were detected in high viscous media compared to liquid culture, indicating higher demand of energy if C. jejuni cells were cultivated in high viscous media. The impact of the surrounding viscosity should be considered in future studies regarding motility related questions.
Introduction
Campylobacter jejuni is one of the major foodborne pathogens world-wide, with 120,946 cases of illness reported to European Food Safety Authority (EFSA) in 2020 [1]. Motility is one of the factors needed for successful host colonization by C. jejuni [2].
The capability of C. jejuni to swarm in high viscous fluids depends on several factors. First, it has been hypothesized that the helical cell shape of C. jejuni contributes to “drilling” movement through mucus fluids in the gastrointestinal tract [3]. Second, flagellation is generally constructed at each pole which facilitate propeller motion to promote cell movement [4]. Third, proton flux passing through flagellar motors generates high torque to facilitate bacterial cells propulsion in viscous fluids [5]. The flagellar motor complex of Campylobacter is composed of a higher number and larger spatial arrangement of the stator complexes (MotAB) compared to those in Escherichia coli (E. coli), thereby generating high torque levels for flagellar rotation even in high viscous surroundings [6].
A flagellum could be divided in several structural parts, namely the motor complex, the rod, hook and the filament. To build a full flagellum a temporal coordinated expression of approximately 40–50 genes is required [7]. The flagellar assembly (FA) processing cascade has been divided into 3 classes [8, 9]. The class 1 genes of the flagellar apparatus mainly encode for the Type III Secretion System (T3SS), MS ring, and C ring which are regulated by σ70 [10]. Once T3SS, composed of FlhA, FlhB, FliP, FliQ and FliR, is initially formed, the MS ring proteins (FliF) and C ring proteins (FliG, FliM, and FliN) are recruited to surround the T3SS apparatus to form a “signal checkpoint”. The completed form of this checkpoint is sensed by the two-component sensor protein FlgS, which in turn activates the response regulator FlgR via phosphotransfer and thereby triggering the subsequent expression of σ54 dependent genes [10]. The proteins, encoded by σ54 dependent genes (class 2), are exported by the T3SS apparatus and construct rod, rings and hook orderly. Once the hook is completed, the anti-sigma factor FlgM is exported through the flagellum and the inhibited σ28 is released to regulate the class 3 flagellar genes expression. The respective proteins are synthesized and released through the flagellum apparatus to form the filament (FlaA and FlaB) and cap (FliD) [8, 11].
Rotation of the flagellum is driven by a motor-complex. The flagellar motor complex is composed of the stator complex (MotA and MotB) and the rotor (C-ring). The stator complex forms a proton flow channel to generate the torque needed for the rotation of the rotor [12], while the C-ring complex transmits the torque to the flagellum, resulting in propulsion of C. jejuni cells [4, 5]. Genes encoding for the C ring complex belong to the class 1 of the FA processing cascade, however, it is reported that the expression of the stator-complex genes motA and motB are independent of the FA processing cascade in C. jejuni [2]. The two stator monomers MotA and MotB facilitate bacterial cell swarming in the viscous environment [4], and the loading of them surrounding the rotor is highly dynamic [12].
Chemotaxis is crucial for directed motility [2, 13, 14]. The bacteria sense molecules in the environment around them and transduce signals by chemotaxis system to the down-stream flagellar rotation system. The methyl-accepting-domain containing chemoreceptor proteins (also called transducer-like proteins, TLP) of C. jejuni could be classified into three groups: Group A TLPs sense signals from the outer environment and Group C from the cytoplasm [14]. The only TLP member of Group B (CetA) builds a bipartite energy taxis system together with CetB [13]. CetB contains a PAS domain, which can sense light, oxygen, proton motive force and the redox state of compounds from electron transport system [15, 16]. CetA conveys the signal obtained from CetB to the core chemotaxis system to control bacterial flagella rotation. Tlp8, belonging to group C TLPs, was also reported to function as energy taxis sensor. C. jejuni is attracted by compounds involved in oxidative phosphorylation metabolism through energy taxis rather than chemotaxis as suggested by Vegge et al. [17]. CetAB navigates C. jejuni towards electron acceptors or donors, while Tlp8 navigates cells away from high redox potentials. By the combination of both systems C. jejuni can maintain an optimal energy and redox balance [14, 16].
The core signal transducing system is a two-component system comprising of the histidine autokinase CheA and the response regulator CheY. CheW functions as a coupling scaffold protein connecting TLPs and CheAY. CheV, a CheW-like protein with an additional response regulator motif, specifically exists in Campylobacter, and might be involved in chemoeffector adaptation [14]. The phosphorylation status of CheY direct the flagellar motor switch proteins FliM or FliM-FliN to counter-clockwise or clockwise rotation respectively.
Bacteria are usually studied as planktonic cells in liquid culture of low viscosity, however bacterial gene expression and behavior might be greatly affected by the surrounding viscosity [18]. Detailed descriptions of the gene expression pattern of C. jejuni swarming in high viscous media are still missing. In general, reports of bacterial RNA extraction from high viscous media remains limited. In this study, an effective method of RNA extraction from C. jejuni within high viscous media has been established. The motility dependent gene expression, derived from C. jejuni of the edge and the center of the swarming halo (SH) in high viscous media and from low viscous culture was determined.
Materials and methods
Bacterial strains and growth conditions
C. jejuni NCTC 11168 were cultivated on Mueller-Hinton agar supplemented with 5% sheep blood (MHB; both Oxoid, Hampshire, UK). The plates were incubated at 37 °C under microaerobic conditions (5% O2, 10% CO2) generated by Anoxomat (Omni Life Science, Bremen, Germany) for 72 h. Overnight culture was obtained by culturing colonies from MHB plates in 5 mL of Brucella broth (BD, Heidelberg, Germany) and incubation at 37 °C under microaerobic conditions for 24 h to enter early stationary phase.
Swarming assay
The overnight culture was 1:10 diluted in Brucella broth to obtain a concentration of approximately 107 colony-forming units (CFU)/mL. 1 μL of the diluted culture was dropped on high viscous media, which was made up of Brucella broth and 0.4% agar. The plates were incubated at 37 °C for 24 h under microaerobic conditions before RNA extraction. The image of bacterial swarming halo in Brucella semisolid agar was captured under Vilber imaging system (Eberhardzell, Germany) with exposure time of 3s.
RNA extraction
For the RNA extraction of the cells derived from liquid culture (low viscous media), 10 mL of the overnight culture was centrifuged at 7,000*g for 5 min. The supernatant was discarded and the bacteria were lysed by the addition of 1 mL of QIAzol (Qiagen, Hilden, Germany). The solution was vortexed for 5 min and incubated at room temperature for 5 min prior to storage at −80 °C. For the RNA extraction of the cells derived from high viscous media, pieces of approximately 1 cm3, including bacterial cells and surrounding agar, was cut out and collected in a sterile Falcon tube. The agar pieces derived from several plates were combined in one Falcon tube to obtain high concentration of bacterial cells. A comparable volume of QIAzol as the volume of the agar pieces was added into the Falcon tube. The solution was vortexed for 5 min and incubated at room temperature for 5 min prior to storage at −80 °C.
The samples were thawed and mixed with 0.2 times volume of chloroform before vortexing for 10 s. The solution was centrifuged at 4 °C and 7,000*g for 15 min. The aqueous phase was collected and mixed with the same volume of 70% ethanol. The solution was vigorously vortexed and immediately loaded onto a RNeasy Midi column (Qiagen) for total RNA extraction according to the manufacturer's instructions. Briefly, samples were centrifuged at 5,000*g for 5 min and the flow through was discarded. Each column was washed once with 4 mL of Buffer RW1 and twice with 2.5 mL of RPE buffer. The RNA was eluted in 100 μL RNase-free water. To obtain a higher total RNA concentration, a second elution step was performed by the first eluate, as recommended by the instruction. The RNA concentration was measured by Nanodrop 2000 (Life Technologies, Darmstadt, Germany).
DNase treatment
Potential residual DNA was destroyed by DNase I (Life Technologies) treatment. Briefly, a total volume of 40 µL working solution was composed of 1 μg of RNA, 1 × reaction buffer with MgCl2, 4 U DNase I and 40 U RiboLock RNase Inhibitor. The solution was incubated at 37 °C for 15 min. EDTA with a final concentration of 5 mM was subsequently added prior to heating at 65 °C for 10 min. The mixture was stored on ice to perform cDNA synthesis subsequently.
cDNA synthesis
The Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Fisher, Vilnius, Lithuania) was used for reverse-transcription of RNA sample. Briefly, a total volume of 15 μL working solution containing 300 ng RNA, 5 µM Random Hexamer Primer and 0.5 mM dNTP Mix was incubated at 65 °C for 5 min. Subsequently 4 µL RT Buffer and 1 µL Maxima H Minus Enzyme Mix was added prior to a second incubation step at 25 °C for 10 min followed by 50 °C for 30 min, and a final heating step at 85 °C for 5 min. The cDNA samples were diluted 1:10 with RNase-free water. A negative control without the addition of Maxima H Minus Enzyme Mix was tested at the same time of cDNA synthesis.
Quantitative real-time PCR
The cDNA products were analyzed by qPCR assay using SsoFastTM EvaGreen Supermix (Bio-Rad, Munich, Germany). The primers listed in Table 1 were designed by previous researchers [19–26] or in this study and synthesized by Metabion International AG (Planegg, Germany). A final volume of 15 μL working mix included 1 × SsoFast Supermix, forward/reverse primers with proper concentrations (mentioned in Table 1) and 1 μL of cDNA. The 2-step-amplification program used was composed of an initial heating step at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s and 55 °C for 15 s, and was finalized by the melting curve analysis. The qPCR assays were carried out by the CFX96TM Real-Time System (Bio-Rad). Ct values was obtained from CFX Manager software (Bio-Rad). ΔCt was calculated by normalization to rpoA. Expression changes between different conditions were calculated as fold change by 2−ΔΔCt method [27]. Changes in the gene expression level >1.5-fold were considered as up-regulated, whereas <0.67-fold as down-regulated.
Primers used in this study
| Category | Primer | Sequence | Target | Final concentration | Function | Reference |
| Inner reference | rpoA-F | CGAGCTTGCTTTGATGAGTG | cj1595 | 300 nM | DNA-directed RNA polymerase subunit alpha | [19] |
| rpoA-R | AGTTCCCACAGGAAAACCTA | |||||
| Chemotaxis | cetA-F | CCTACCATGCTCTCCTGCAC | cj1190 | 300 nM | bipartite energy taxis response protein | [20] |
| cetA-R | CGCGATATAGCCGATCAAACC | |||||
| cetB-F | GCCTTGTTGCTGTTCTGCTC | cj1189 | 300 nM | bipartite energy taxis response protein | [20] | |
| cetB-R | TTCCGTTCGTCGTATGCCAA | |||||
| cheA-F | GCTTCAGGTAGTAATGCTA | cj0284c | 300 nM | two-component system, chemotaxis family, sensor kinase | [21] | |
| cheA-R | TAACGCTCTTCAACATCA | |||||
| cheV-F | TTCGTGGAGTGGTTATAC | cj0285c | 300 nM | two-component system, chemotaxis family, chemotaxis protein | [21] | |
| cheV-R | AAGTTGCTGGTTCTATATCT | |||||
| cheW-F | ATGGCTGGTCCTGATGTCG | cj0283c | 300 nM | purine-binding chemotaxis protein CheW | [22] | |
| cheW-R | CCAGCATTTCCTCCAACTCC | |||||
| cheY-F | GCTTCAGGTAGTAATGCTA | cj1118c | 300 nM | two-component system, chemotaxis family, chemotaxis protein | [21] | |
| cheY-R | TAACGCTCTTCAACATCA | |||||
| tlp8-F | GAGGATGTTAATCAGAGTGT | cj1110 | 300 nM | MCP-type signal transduction protein | [21] | |
| tlp8-R | TTAGCAACTTCAGCAGAG | |||||
| Flagella assembly | flaA-F | CAGCAGAATCGCAAATCCGT | cj1339c | 300 nM | flagellin A | This study* |
| flaA-R | CCATGGCATAAGAGCCGCTT | |||||
| flaB-F | GTTAAAGCAGCTGAATCAACCA | cj1338c | 300 nM | flagellin B | This study | |
| flaB-R | ACTCATAGCATAAGAACCTGATTG | 900 nM | ||||
| flgD-F | TATGCAAAAATGGCTGGACA | cj0042 | 300 nM | flagellar hook assembly protein | This study | |
| flgD-R | TGAACCGCTTCCTCCAGTAG | |||||
| flgE-F | TGCGATGGATGTTGAAGGTA | cj0043 | 300 nM | flagellar hook protein | This study | |
| flgE-R | CCCAAAATCTGCACGAGAAT | |||||
| flgG2-F | GCGTTGATAAAAACGGAAGC | cj0697 | 300 nM | flagellar basal-body rod protein | This study | |
| flgG2-R | CCCATCTTTTTGCAAAGCTC | |||||
| flgH-F | TTTTTGGTTGTTCTGCAACG | cj0687c | 300 nM | flagellar basal body L-ring protein | This study | |
| flgH-R | TTGCTTTGTTTTGGTGCAAG | |||||
| flgI-F | TGCAGTGCAAATCAAGGATG | cj1462 | 300 nM | flagellar basal body P-ring protein | This study | |
| flgI-R | CGCTTCCATTAAGCCCTACA | |||||
| flgK-F | GCGTTTTCCCGACTTACAAA | cj1466 | 300 nM | flagellar basal body P-ring protein | This study | |
| flgK-R | TTTTCGTTGGGGTTAGATGC | |||||
| flhA-F | TAAGCGAAGGGCAAAACGG | cj0882c | 300 nM | flagellar biosynthesis protein | [21] | |
| flhA-R | AATACAAAATACAATCACGCCAATG | |||||
| flhB-F | GCAGGTGCGGATGTGGTG | cj0335 | 300 nM | flagellar biosynthesis protein | [21] | |
| flhB-R | TTGTTTTATGCGAAGAGCGAGA | |||||
| fliD-F | GGATTTGGTTCTGGGGTTTT | cj0548 | 300 nM | flagellar hook-associated protein 2 | This study | |
| fliD-R | CGAGCTTTTTGCTCTGCTTC | |||||
| fliM-F | CAAACCGTGATATTATGATGGGTG | cj0060c | 300 nM | flagellar motor switch protein | [21] | |
| fliM-R | ATACCACTTCAGCACGACCGA | |||||
| fliS-F | CCCCGCAAAAACTTATTGAA | cj0549 | 300 nM | flagellar secretion chaperone | This study | |
| fliS-R | CTCTTGCACAAAAACGCAAA | |||||
| motA-F | CGGGTATTTCAGGTGCTT | cj0337c | 300 nM | flagellar motor complex protein | This study | |
| motA-R | CCAAGGAGCAAAAAGTGC | |||||
| motB-F | AATGCCCAGAATGTCCAGCA | cj0336c | 300 nM | flagellar motor complex protein | [23] | |
| motB-R | AGTCTGCATAAGGCACAGCC | |||||
| Sigma factors & regulators | flgM-F | TGGCAAATACCGCATTAAATA | cj1464 | 300 nM | flagellar biosynthesis protein FlgM | [24] |
| flgM-R | GCTGTAGCTTTTGTATCGATTTTATAAG | |||||
| fliA-F | GCCTAAAGCTTATGCACAAATGC | cj0061c | 300 nM | RNA polymerase sigma factor FliA | [24] | |
| fliA-R | CGTTCTTTTAGTCTAAAAGCCATAGCA | |||||
| rpoD-F | GAACGAATTTGATTTAGCCAATGA | cj1001 | 300 nM | RNA polymerase primary sigma factor | [25] | |
| rpoD-R | CCCATTTCTCTTAAATACATACGAACAG | |||||
| rpoN-F | ATCGGGCTCTTTGCTTGCTA | cj0670 | 300 nM | RNA polymerase sigma-54 factor | [26] | |
| rpoN-R | AATCGGCAACCAAGAGCGTA | |||||
| flgR-F | CGGTTCGTTTGGGAGTAAAA | cj1024c | 300 nM | two-component system response regulator; sigma-54 associated transcriptional activator | This study | |
| flgR-R | GCACGCTTAATAGCCTCGAC |
*Designed in this experiment using primer prism 3 software.
Results
Flagellar associated gene expression pattern of C. jejuni swarming in high viscous media
The expression of selected genes belonging to the flagellar apparatus were investigated during cultivation in viscous media. After 24 h incubation a bacterial swarming halo (SH) was formed due to bacterial growth and swarming starting from the center spot (Fig. 1). Agar pieces, containing bacterial cells, were collected from the SH Center or SH Edge to extract RNA. The gene expression pattern of C. jejuni cells swarming in high viscous media was compared between the SH Center and the SH Edge (Fig. 2).
The image of C. jejuni swarming halo on the surface of BB semisolid agar. The isolation spot was marked in dashed circles. SH: swarming halo
Citation: European Journal of Microbiology and Immunology 13, 1; 10.1556/1886.2023.00006
Higher mRNA levels of class 1 and lower levels of class 2 genes in cells derived from the SH Edge compared to cells derived from the SH Center. The expression level of selected genes was analyzed by semiquantitative real-time PCR, and differential expression pattern determined by the 2−ΔΔCT method. Each floating bar depicted the median of 3 independent biological replicates and the min to max of the data range. The dash line indicates the threshold for differential gene expression with >1.5-fold (up-regulation) or <0.67 (down-regulation). Genes are classified into different groups: chemotaxis (red), flagellar assembly processing cascade (class 1: gold; class 2: green; class 3: blue), as well as not classified genes (purple)
Citation: European Journal of Microbiology and Immunology 13, 1; 10.1556/1886.2023.00006
In total, the expression of 6 out of 18 flagellar assembly (FA) processing genes were up-regulated and of 9 genes were down-regulated by comparing the expression pattern of the SH Edge with the SH Center. The up-regulated genes belong to the class 1 of the FA process, which include the T3SS components flhA, flhB, the C ring component fliM, and the transcriptional regulators rpoD (σ70), rpoN (σ54) and flgR (two-component response regulator). The investigated genes which were down-regulated mostly belong to the class 2 genes. These include the rings and rod associated genes flgI, flgH and flgG2, the hook associated genes flgD, flgE, flgK, as well as the minor flagellin flaB. Furthermore, the expression of the gene flgM, encoding the anti-σ28 factor, was down-regulated. In contrast, the expression of fliA, encoding the σ28 factor, was only slightly enhanced, but was closely below the threshold for being labelled as up-regulated. While the expression of the flagellin gene flaA was down-regulated, the expression of the genes fliD (encoding the filament capping protein) and fliS (encoding an export chaperon), also belonging to class 3, did not differ in their expression levels. The expression of both motor complex encoding genes (motA and motB) were slightly enhanced, but only motA reached the threshold being considered as up-regulated.
Gene expression of C. jejuni swarming in high viscous media compared to liquid culture
The gene expression pattern of cells derived from liquid culture (low viscous media) was further compared to the patterns derived from either SH Edge or SH Center in high viscous media (Fig. 3). In the SH Center (Fig. 3A), most of the investigated genes associated with the FA process with up-regulated expression belong to class 2 and 3, except for fliA and fliD, while the genes with down-regulated expression belong to class 1. By comparing mRNA levels from the SH Edge with the liquid culture (Fig. 3B), differentially expressed genes associated with the FA process encode for regulatory proteins (rpoD, flgR, up-regulated; fliA, down-regulated) or structural proteins (flhB, flgD, flaB, fliD, down-regulated). The remaining 11 out of 18 genes were not differently expressed.
Heat map of gene expression pattern from high viscous media compared to low viscous media. Fold changes of gene expression from the bacterial cells at the SH Center (A) or SH Edge (B) from high viscous media was compared to that from liquid culture, respectively. The expression level of selected genes was analyzed by semiquantitative real-time PCR, and differential expression pattern determined by the 2−ΔΔCT method. Each result represents the median from 3 independent biological replicates with 2 technical replicates for each. The significant results shown here were determined as > 1.5-fold (up-regulation, red color) or <0.67 (down-regulation, green color). Data range were shown in supplementary figures S1 and S2
Citation: European Journal of Microbiology and Immunology 13, 1; 10.1556/1886.2023.00006
Among these selected genes, it is noticeable that the expression of a couple of genes is regulated in the same direction in both SH Center and SH Edge compared to liquid culture (Fig. 3). These included up-regulated expression of the motor complex genes (motA and motB) and chemotaxis related genes (cetB, cheV, and tlp8), as well as down-regulated expression of the genes flhB, fliA and fliD, whereas for three genes the direction of regulation was the opposite between SH Center and SH Edge compared to liquid culture. Of these genes, rpoD and flgR were down-regulated in the SH Center and up-regulated at the SH Edge compared to the liquid culture. The expression of flaB was regulated in the opposite way. Further, cheA, cheW, cheY and flgK did not show expression differences.
Discussion
Differential expression of FA processing genes at the SH center and SH edge in high viscous media
While cultivating bacterial cells in liquid culture results in a quite homogenous cell population, cultivating bacteria in highly viscous media results in an inhomogenous cell population. For E. coli it has been reported that near the SH Edge highly motile cells are apparent while in the SH center less motile cells are stacked in a three-dimensional structure with many layers [28]. Additionally, growth of bacterial cells located at the SH center is limited by competition for nutrients. In contrast, the cells at the SH Edge remain rapidly growing [29]. Therefore, we expected different gene expression pattern in C. jejuni cells located at the SH Center and the SH Edge in high viscous media. Given that the flagellum is essential for bacterial cell motility, genes associated with the FA process were investigated.
Genes associated with the FA process are commonly divided into 3 classes, and the expression of each class is regulated by a different sigma factor, σ70 (RpoD), σ54 (RpoN) and σ28 (FliA), respectively. In this study, we observed that the genes with up-regulated expression at the SH Edge compared to the SH Center (rpoD, flhA, flhB, fliM, rpoN and flgR), belong to class 1 of the FA process. Meanwhile, down-regulated genes flgI, flgH, flgG2, flgD, flgE, flgK, and flaB, which are σ54 dependent and encode for hook basal body proteins and flagellin minor protein, belong to class 2. Similar to the expression pattern of the class 2 genes, the expression of the class 3 flagellar gene, the flagellin major monomer gene flaA, was down-regulated. In the FA processing, the class 2 genes are activated through interaction of FlgR and σ54 after the T3SS-MS-C ring complex construction is completed [10, 11, 30]. This clear pattern of opposite regulated expression between class 1 and class 2 & 3 genes suggested that different FA processing stages were determined from the majority of bacterial cells at the SH Center and the SH Edge in high viscous media. Wright and colleagues [31] performed a gene expression analysis throughout the growth curve of C. jejuni NCTC 11168 in liquid culture. They have shown a continuous down-regulated expression of class 1 genes and up-regulated expression of several class 2 and 3 genes from late exponential until late stationary phase. Even though these differences were not statistically significant, they have shown a trend of flagellar gene expression during the stationary phase. We suggest that the bacterial cell at the SH Center were older than the cells at the SH Edge. This hypothesis is corroborated as the cells at the SH Center also possessed down-regulated expression of class 1 and up-regulated expression of class 2 and 3 genes compared to cells derived from the SH Edge. This would suggest that the majority of the cells at the SH Center are in late stationary phase while a majority of cells at the SH Edge were in the late exponential/early stationary phase. These differences through the growth phase could explain the different gene expression patterns determined at the SH Edge and SH Center. Further proof is needed to verify this hypothesis.
In the FA processing model of Salmonella Typhimurium and E. coli, the expression of the σ28-dependent flagellar assembly genes of class 3 are not activated until the hook is completed, due to the negative regulation by FlgM binding σ28 [32, 33]. Once the hook is constructed, FlgM is secreted in the environment, enabling unbound σ28 to activate the expression of flaA as well as of other class 3 genes [24]. However, in our study, only the expression of flaA was down-regulated at the SH Edge compared to the SH Center, while the other class 3 genes (fliD and fliS) did not show differential expression (Fig. 2). One hypothesis might be that flaA is partially transcribed before hook completion. Even though the expression of the flaA gene is commonly reported to be regulated by σ28 [2, 34], Hendrixson and colleagues have reported that flaA expression was only partially defective in the C. jejuni 81–176ΔfliA mutant [35]. Furthermore, Dugar et al. described continuous flaA expression in C. jejuni, with highest mRNA level reached in overnight cultures [36]. Therefore, it seems plausible that the observed flaA expression level at the SH center is σ28 independent.
Loading of the motor complex by the stators MotA and MotB is a highly dynamic process [12]. Given that high loading of motor stator monomers facilitates bacterial cell's swarming in viscous media, the slightly up-regulated expression of both genes motA and motB in our study might indicate higher demand of the stator complex within the cells at the SH Edge compared to cells located at the SH Center in high viscous media. This is in line with the description for E. coli SHs, in which cells located at the SH Center were less motile compared to cells located near the SH Edge [28].
Genes differentially expressed in high viscous media and liquid culture
As gene expression studies are mostly conducted from liquid cultures, we further analyzed the differences in motility related gene expression of cells derived from high and low viscous media. The expression pattern of genes belonging to FA processing cascade (class 1, 2 and 3) derived from the SH Center compared to liquid culture was shown in Fig. 3A. In the SH Center, the expression of class 1 genes was down-regulated while an up-regulation was determined for most of the class 2 and 3 gene expressions. Meanwhile, the expression of flgD and flgK did not show significant regulation, whereas expression of fliA and fliD were down-regulated. Based on the data ranges of flgD and flgK (Fig. S1), both genes have shown similar trends as the remaining class 2 genes. Therefore, we deduced that the non-differential expression of both flgD and flgK were due to the systematic error. In contrast, in the gene expression pattern derived from the SH Edge compared to liquid culture (Fig. 3B), most of the genes related to the FA process have shown no differences (Fig. S2). Our data let us speculate that bacterial cells in the SH Center have mostly finished the FA process, while cells derived from liquid culture and the SH Edge are still in the process of flagellar assembly.
Combining the expression patterns of genes sharing comparable regulation trends at SH Center and SH Edge compared to liquid culture (Fig. 3 AB), we observed that the gene expressions for σ28 (fliA), filament capping protein (fliD) and a T3SS component (flhB) were down-regulated in high viscous media. These genes play a central role in the FA process, however, their predominant expression in liquid culture compared to high viscous media remains unclear. Further experiments need to be conducted upon this topic.
However, the expression of the stator complex genes (motA and motB) as well as of genes involved in sensing energy taxis (cheV, cetB, tlp8) were up-regulated in high viscous media compared to liquid culture. As the result of competing with each other for access to nutrients, bacterial cells continue to rapidly grow after swarming to the SH Edge, while in the liquid culture, these cells would be eventually forced to balance growth and death [29]. We deduced that the high regulation level of energy taxis gene expressions was required for sensing favorable conditions to provide the higher energy needed for torque generation in high viscous media. Our results suggest that the movement of the cells to favorable conditions at the SH Edge needed higher energy in high viscous media.
Conclusion
In this study, differences in the C. jejuni gene expression pattern of the flagella apparatus were observed between cells derived from the SH Center and SH Edge in high viscous media. However, the expression pattern of these genes in liquid culture resembles that of cells derived from the SH Edge rather than cells derived from the SH Center in high viscous media. Nevertheless, genes belonging to energy taxis and energy conversion are higher expressed in high viscous media compared to liquid culture. Altogether this indicates that questions regarding the flagellar assembly process could be investigated from liquid cultures while questions regarding the swarming process itself should be investigated in high viscous media rather than in liquid cultures.
Statements
Ethics statement
Not applicable.
Funding sources
This work is supported by the German Federal Ministry of Education and Research (BMBF) in frame of the zoonoses research consortium PAC-Campylobacter (project IP2/01KI1725A) and China Scholarship Council (CSC).
Authors' contributions
GG and TA supervised the study; YS and GG designed experiments; YS performed experiments and wrote the paper; YS and GG analyzed data; YS, GG and TA made paper revisions.
Conflict of interest
The authors declare no conflict of interest.
Supplementary material
Supplementary data to this article can be found online at https://doi.org/10.1556/1886.2023.00006.
References
- 2.↑
Lertsethtakarn P, Ottemann KM, Hendrixson DR. Motility and chemotaxis in Campylobacter and Helicobacter. Annu Rev Microbiol 2011;65:389–410.
- 3.↑
Frirdich E, Vermeulen J, Biboy J, Soares F, Taveirne ME, Johnson JG, et al. Peptidoglycan LD-carboxypeptidase Pgp2 influences Campylobacter jejuni helical cell shape and pathogenic properties and provides the substrate for the DL-carboxypeptidase Pgp1. J Biol Chem 2014 Mar 21;289(12):8007–8018.
- 4.↑
Cohen EJ, Nakane D, Kabata Y, Hendrixson DR, Nishizaka T, Beeby M. Campylobacter jejuni motility integrates specialized cell shape, flagellar filament, and motor, to coordinate action of its opposed flagella. Plos Pathog 2020 Jul;16(7):e1008620.
- 5.↑
Henderson LD, Matthews-Palmer TRS, Gulbronson CJ, Ribardo DA, Beeby M, Hendrixson DR. Diversification of Campylobacter jejuni flagellar C-ring composition impacts its structure and function in motility, flagellar assembly, and cellular processes. mBio 2020 Jan 7;11(1).
- 6.↑
Burnham PM, Hendrixson DR. Campylobacter jejuni: collective components promoting a successful enteric lifestyle. Nat Rev Microbiol 2018 Sep;16(9):551–565.
- 7.↑
Hendrixson DR. Regulation of flagellar gene expression and assembly. In: Nachamkin I, Szymanski CM, MJ B, editors. Campylobacter. 3rd ed. Washington, DC, USA: ASM Press; 2008. pp. 543-558.
- 8.↑
Aldridge P, Hughes KT. Regulation of flagellar assembly. Curr Opin Microbiol 2002 Apr;5(2):160–165.
- 9.↑
Radomska KA, Wosten M, Ordonez SR, Wagenaar JA, van Putten JPM. Importance of Campylobacter jejuni FliS and FliW in flagella biogenesis and flagellin secretion. Front Microbiol 2017;8:1060.
- 10.↑
Boll JM, Hendrixson DR. A regulatory checkpoint during flagellar biogenesis in Campylobacter jejuni initiates signal transduction to activate transcription of flagellar genes. mBio 2013 Sep 3; 4(5):e00432–13.
- 11.↑
Soutourina OA, Bertin PN. Regulation cascade of flagellar expression in Gram-negative bacteria. FEMS Microbiol Rev 2003 Oct;27(4):505–523.
- 12.↑
Baker AE, O'Toole GA. Bacteria, rev your engines: stator dynamics regulate flagellar motility. J Bacteriol 2017 Jun 15;199(12).
- 13.↑
Chandrashekhar K, Kassem, II, Rajashekara G. Campylobacter jejuni transducer like proteins: chemotaxis and beyond. Gut Microbes 2017 Jul 4; 8(4):323–334.
- 14.↑
Zautner AE, Tareen AM, Gross U, Lugert R. Chemotaxis in Campylobacter jejuni. Eur J Microbiol Immunol (Bp) 2012 Mar;2(1):24–31.
- 15.↑
Elliott KT, Dirita VJ. Characterization of CetA and CetB, a bipartite energy taxis system in Campylobacter jejuni. Mol Microbiol 2008 Sep;69(5):1091–1103.
- 16.↑
Reuter M, van Vliet AH. Signal balancing by the CetABC and CetZ chemoreceptors controls energy taxis in Campylobacter jejuni. PLoS One 2013;8(1):e54390.
- 17.↑
Vegge CS, Brondsted L, Li YP, Bang DD, Ingmer H. Energy taxis drives Campylobacter jejuni toward the most favorable conditions for growth. Appl Environ Microbiol 2009 Aug;75(16):5308–5314.
- 18.↑
Boric M, Danevcic T, Stopar D. Viscosity dictates metabolic activity of Vibrio ruber. Front Microbiol 2012;3:255.
- 19.↑
Ritz M, Garenaux A, Berge M, Federighi M. Determination of rpoA as the most suitable internal control to study stress response in C. jejuni by RT-qPCR and application to oxidative stress. J Microbiol Methods 2009 Feb;76(2):196–200.
- 20.↑
Wagle BR, Arsi K, Upadhyay A, Shrestha S, Venkitanarayanan K, Donoghue AM, et al. Betafresorcylic acid, a phytophenolic compound, reduces Campylobacter jejuni in postharvest poultry. J Food Prot 2017 Aug;80(8):1243–1251.
- 21.↑
Du X, Kong K, Tang H, Tang H, Jiao X, Huang J. The novel protein Cj0371 inhibits chemotaxis of Campylobacter jejuni. Front Microbiol 2018;9:1904.
- 22.↑
Reuter M, Ultee E, Toseafa Y, Tan A, van Vliet AHM. Inactivation of the core cheVAWY chemotaxis genes disrupts chemotactic motility and organised biofilm formation in Campylobacter jejuni. FEMS Microbiol Lett. 2020 Jan 15;367(24).
- 23.↑
Upadhyay A, Arsi K, Wagle BR, Upadhyaya I, Shrestha S, Donoghue AM, et al. Trans-cinnamaldehyde, carvacrol, and eugenol reduce Campylobacter jejuni colonization factors and expression of virulence genes in vitro. Front Microbiol 2017;8:713.
- 24.↑
Wosten MM, van Dijk L, Veenendaal AK, de Zoete MR, Bleumink-Pluijm NM, van Putten JP. Temperature-dependent FlgM/FliA complex formation regulates Campylobacter jejuni flagella length. Mol Microbio 2010 Mar;75(6):1577–1591.
- 25.↑
Klancnik A, Botteldoorn N, Herman L, Mozina SS. Survival and stress induced expression of groEL and rpoD of Campylobacter jejuni from different growth phases. Int J Food Microbiol 2006 Dec 1;112(3):200–207.
- 26.↑
Koolman L, Whyte P, Burgess C, Bolton D. Virulence gene expression, adhesion and invasion of Campylobacter jejuni exposed to oxidative stress (H2O2). Int J Food Microbiol 2016 Mar 2;220:33–38.
- 27.↑
Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008;3(6):1101–1108.
- 28.↑
Copeland MF, Weibel DB. Bacterial swarming: a model system for studying dynamic self-assembly. Soft Matter 2009;5(6):1174-1187.
- 29.↑
Kaiser D. Bacterial swarming: a re–examination of cell-movement patterns. Curr Biol 2007 Jul 17;17(14):R561–R570.
- 30.↑
Matz C, van Vliet AHM, Ketley JM, Penn CW. Mutational and transcriptional analysis of the Campylobacter jejuni flagellar biosynthesis gene flhB. Microbiology (Reading) 2002 Jun;148(Pt 6):1679–1685.
- 31.↑
Wright JA, Grant AJ, Hurd D, Harrison M, Guccione EJ, Kelly DJ, et al. Metabolite and transcriptome analysis of Campylobacter jejuni in vitro growth reveals a stationary-phase physiological switch. Microbiology (Reading) 2009 Jan;155(Pt 1):80–94.
- 32.↑
Chilcott GS, Hughes KT. Coupling of flagellar gene expression to flagellar assembly in Salmonella enterica serovar Typhimurium and Escherichia coli. Microbiol Mol Biol Rev 2000 Dec;64(4):694–708.
- 33.↑
Anderson JK, Smith TG, Hoover TR. Sense and sensibility: flagellum-mediated gene regulation. Trends Microbiol 2010 Jan;18(1):30–37.
- 34.↑
Jagannathan A, Constantinidou C, Penn CW. Roles of rpoN, fliA, and flgR in expression of flagella in Campylobacter jejuni. J Bacteriol 2001 May;183(9):2937–2942.
- 35.↑
Hendrixson DR, DiRita VJ. Transcription of sigma54-dependent but not sigma28-dependent flagellar genes in Campylobacter jejuni is associated with formation of the flagellar secretory apparatus. Mol Microbiol 2003 Oct;50(2):687–702.
- 36.↑
Dugar G, Svensson SL, Bischler T, Waldchen S, Reinhardt R, Sauer M, et al. The CsrA-FliW network controls polar localization of the dual-function flagellin mRNA in Campylobacter Jejuni Nat Commun 2016 May 27;7:11667.
