Abstract
This work aimed to investigate interactions between antibody-opsonized SARS-CoV-2 and monocytes enriched from human peripheral blood mononuclear cells (PBMC) to determine whether antibody dependent enhancement might contribute to the pathophysiology of COVID-19. Pre-incubation of SARS-CoV-2 with sera from hospitalized COVID-19 patients led to significantly increased virus uptake and viral replication in monocytes. Remarkably, SARS-CoV-2 pre-incubated with sera from patients with severe COVID-19 but not those with mild disease or post vaccination strongly increased IL-6 secretion by monocytes. Antibody dependent viral uptake was partially inhibited by monoclonal anti-FcγRIIa antibody whereas IL-6 secretion was completely abolished. FcγRIIa preferentially binds IgG2, and sera from patients with severe COVID-19 contained lower IgG2 levels as compared to mild COVID-19 cases whereas IgG1 levels were increased. These data suggests that FcγRIIa-mediated binding of antibody-opsonized SARS-CoV-2 critically impacts monocytic inflammatory cytokine release and COVID-19 pathophysiology.
Introduction
Since the onset of the SARS-CoV-2 (severe acute respiratory syndrome coronavirus type 2) pandemic in Wuhan (Hubei, China) in December 2019 [1–3], the virus has spread across the globe at a fast pace. It was quickly identified as a new β-coronavirus of the enveloped positive-stranded RNA coronavirus family.
SARS-CoV-2 causes respiratory and systemic infections with a wide range of symptoms, which are named with the acronym COVID-19 (coronavirus disease 2019) [4–7]. IL-6 has become one important parameter for monitoring disease progression of the highly variable clinical manifestations of COVID-19 [8]. To enter cells, both SARS-CoV [9] and SARS-CoV-2 bind to the cellular receptor ACE2 (angiotensin converting enzyme 2) [10]. Although several cell types express ACE2, the complex symptoms of COVID-19 cannot be solely explained by ACE2-related virus tropism [9, 10].
The immune response to viral infections is characterized by the production of antibodies that can either neutralize or enhance the virus's ability to infect cells. Neutralizing antibodies are highly effective at preventing viral host cell entry or by binding to specific epitopes and presents the antigen to effector cells that ultimately lead to the virus's destruction [11–13]. In contrast, non-neutralizing antibodies can have a more complex role, and in some cases, can even facilitate viral entry and replication [14]. This phenomenon, known as antibody-dependent enhancement (ADE) and was first described in the 1960s [15] and has since been observed in a number of viral infections, particularly in dengue hemorrhagic fever and dengue shock syndrome caused by the dengue virus (DENV).
Fc receptors (FcRs) play a critical role in ADE, by enabling non-neutralizing antibodies to bind to immune cells through theirFc domains. This interaction facilitates viral entry into cells and activates immune cells as well as the complement system through the virus-antibody immune complex [16, 17].
Nevertheless, the phenomenon of antibody-dependent enhancement remains a complex and poorly understood aspect of viral immunology, leaving many questions about its mechanisms still unanswered. A recent case study of a not immunized 58-year-old patient with obesity who received intravenous monoclonal antibody therapy for COVID-19 highlights the potential risks of ADE, as the treatment led to a severe exacerbation of the disease, characterized by a rapid progression of COVID-19 pneumonia [18].
Fc receptors (FcRs) are frequently involved in virus-host interactions especially on monocytes, and they are widely expressed on myeloid and lymphoid cells [19]. FcRs belong to the immunoglobulin superfamily (IgSF) receptors and regulate processes of humoral and innate immunity and play a key role for responses to infections. After cross-linking by immune complexes (ICs), FcRs mediate modulation of the immune response via phagocytosis and cytokine release.
The different FcγR types display specific binding affinities for different Ig subclasses. While all FcγRs bind to IgG1 and IgG3, FcγRI (CD64) and FcγRIIa (CD32A) additionally bind to IgG4, and IgG2 binding is mediated mainly through FcγRIIa. The affinity for IgG2 differs among the various known FcγRIIa alleles [22], leading to functional heterogeneity of the receptor. An allelic dimorphism has been described for the FcγRIIa receptor, or rather for its encoding gene FCGR2A (rs1801274 c.500A > G, p.His131Arg https://www.ncbi.nlm.nih.gov/snp/rs1801274), which results in a change from histidine to arginine at position 131 (H131R; alias H166R) in the second Ig-like domain of FcγRIIa [20, 21]. Increased affinity to IgG1 and in particular IgG2 was reported for the H isoform, whereas the R isoform has a comparatively lower affinity to IgG1 and IgG2. The binding affinity to IgG3 and IgG4 is not changed significantly by this amino acid substitution [22]. FcγRIIa has been reported in previous studies to be involved in antibody-dependent enhanced uptake of dengue virus and feline infectious peritonitis virus (FIPV) [23, 24]. In a recent preprint, FcγRII was reported to be involved in antibody-dependent uptake of SARS-CoV-2 pseudovirions [25]. Furthermore, sera derived from hospitalized COVID-19 patients can mediate antibody-dependent entry of virus into monocytes, which leads to inflammasome-dependent cell death and inflammation [26]. Since the receptor FcγRIIa is an activating and major phagocytic receptor [27], we hypothesized that it contributes to higher virus infection rates and activation of monocytes. Here, we investigated FcγRIIa's role in mediating interaction of SARS-CoV-2 with monocytes.
Materials and methods
Virus isolation and genome sequencing
All experiments were performed using the SARS-CoV-2 strain Goe18B6 which is similar to the Wuhan-Hu-1 reference genome. This isolate has been cultured from a patient's throat swab taken in August 2020 at the University Medical Center Göttingen, Germany. Virus stocks were produced on Vero E6 cells maintained in OptiPRO™ SFM supplemented with 50 units/mL penicillin and 50 μg mL−1 streptomycin (Gibco/ThermoFisher Scientific, Dreieich, Germany).
Virus sample was sequenced on an Illumina HiSeq 4000 instrument (SE; 50 bp; 8 × 107 reads/sample). Sequence images were transformed with Illumina software BaseCaller to BCL files and demultiplexed to fastq files with bcl2fastq v2.20. The sequencing quality was verified using FastQC.
Sequences were aligned to the SARS-CoV-2 reference genome [28] using the RNA-Seq alignment tool Bowtie 2 [29]. SNPs were identified using the Genome Analysis Toolkit (GATK) [30].
The SARS-CoV-2 Goe18B6 genome sequence has been deposited at GISAID (www.gisaid.org) under accession number EPI_ISL_745090.
Antibodies and human serum
Both purified NA/LE mouse anti-human CD64 (BD Pharmingen, San Diego, CA, USA) and anti-human CD32 (InVivoMAb, Lebanon, NH, USA) were used at 23 µg per 200.000 cells. Routinely drawn sera of three COVID-19-patient cohorts with different degrees of COVID-19 severity according to the WHO categorization were included in the study: cohort (I) consisted of samples from 24 mild (WHO category D) cases and cohort (II) of 27 samples from critical and very severe (WHO category A&B) COVID-19 cases. Infection of these patients had been confirmed before using SARS-CoV-2-specific RT-PCR assays (Genesig Real-Time PCR Coronavirus assay, Primerdesign Ltd., Chandlers Ford, UK) from respiratory samples with first-time positive results confirmed using automated Cepheid Xpert Xpress SARS-CoV-2 PCR (Cepheid, Sunnyvale, CA, USA). All patient sera from cohorts I and II had previously been tested positive for anti-SARS-CoV-2 IgG using five different assays [31]. The negative control cohort (III) consisted of samples from 42 blood donors taken in 2018, before the onset of the COVID-19 pandemic. Further, serum from an individual who was vaccinated twice against SARS-CoV-2 with an mRNA-based vaccine and without prior SARS-CoV-2 infection was also used.
For the co-incubation of SARS-CoV-2 with THP-1 and PBMC-derived monocytes, sera from six patients with mild or severe COVID-19 disease and with specific antibodies against SARS-CoV-2 spike protein, one post SARS-CoV-2 vaccination serum and one SARS-CoV-2-negative blood donor serum were used from the cohorts. For cell culture experiments, patients' sera were inactivated at 56 °C for 30 min.
Neutralization assay
All for this study used test sera were assessed for neutralizing antibodies using the surrogate neutralization assay TECO SARS-CoV-2 Neutralization Antibody Assay (TECOmedical AG, Sissach, Switzerland), as previously described [32].
Human-derived PBMCs and enrichment of monocytes
Buffy coats were obtained from the Central Department of Transfusion Medicine of the University Medical School Göttingen, Germany. All donors gave written informed consent and use of human PBMCs was approved by the Ethics commission of the University Medical School Göttingen (Project number 26/2/19). All donations of patient material were performed in accordance with the German Transfusion Act (Transfusionsgesetz – TFG), and all donors were individuals not suffering from viral infections as confirmed by negative results of HBV (hepatitis B virus), HCV (hepatitis C virus) and HIV (human immunodeficiency virus). Each monocyte culture was generated from a different donor and not pooled with other donors at any given time during sample collection or during the course of this study. Peripheral blood mononuclear cells (PBMCs) were isolated by density gradient centrifugation (Ficoll-Paque Plus, GE Healthcare Life Sciences, Freiburg, Germany) at 900 × g for 30 min of blood diluted in RPMI 1640 medium (Gibco/ThermoFisher Scientific, Dreieich, Germany). PBMCs were washed extensively, and monocytes were then enriched by allowing them to adhere to polystyrene cell culture dishes (Greiner Bio-One, Frickenhausen, Germany) in RPMI 1640 medium (Gibco/ThermoFisher Scientific, Dreieich, Germany) supplemented with 100 U mL−1 penicillin and 100 μg mL−1 streptomycin (Gibco/ThermoFisher Scientific, Dreieich, Germany) for 2 h at 37 °C and subsequent removal of non-adherent cells. Monocyte-enriched PBMCs from each single donor were directly analyzed, or they were cryopreserved in RPMI 1640 (Gibco/ThermoFisher Scientific, Dreieich, Germany) containing 20% FCS (fetal calf serum, Gibco/ThermoFisher Scientific, Dreieich, Germany) and 10% dimethyl sulfoxide by freezing at a cooling rate of 1 °C per minute in liquid nitrogen.
Cell culture and infection assays
THP-1 human monocytic cells were cultivated in DMEM (Gibco/ThermoFisher Scientific, Dreieich, Germany) supplemented with 10% FCS (Gibco/ThermoFisher Scientific, Dreieich, Germany), 100 U mL−1 penicillin and 100 μg mL−1 streptomycin (Gibco/ThermoFisher Scientific, Dreieich, Germany) in a humidified atmosphere with 5% CO2 at 37 °C. Cells were seeded at a density of 200.000 cells per 250 µL medium per well in a 24-well microtiter plate. A SARS-CoV-2 suspension containing 3.5 × 106 viral particles was used to infect 200.000 cells (17.5 vpc). Prior to infection, viruses were incubated with patients' sera from cohort I and cohort II individually that were not pooled, thus generating a single infection assay for each patient serum. Samples were mixed gently with RPMI medium (Gibco/ThermoFisher Scientific, Dreieich, Germany) at various dilutions (1:32, 1:64, 1:128 and 1:256), incubated at room temperature for 15 min and finally added to the cells. As controls, SARS-CoV-2 without serum pre-treatment, and as negative control non-infected THP-1 cells or PBMC-derived monocytes were used. 24 h post infection, cells were harvested and centrifuged at 1,000 × g for 10 min. Pellets were washed twice with PBS (Merck, Darmstadt, Germany), and cells were finally resuspended in 200 µL PBS (Merck, Darmstadt, Germany) before preparing the samples for RT-qPCR (see Genesig SARS-CoV-2 RT-qPCR). Each measurement was performed in technical duplicates and biological triplicates.
PBMC-derived monocytes were thawed from −80 °C stocks and suspended in RPMI medium (Gibco/ThermoFisher Scientific, Dreieich, Germany) supplemented with 10% FCS (Gibco/ThermoFisher Scientific, Dreieich, Germany), 100 U mL−1 penicillin and 100 μg mL−1 streptomycin (Gibco/ThermoFisher Scientific, Dreieich, Germany). Cells were cultivated and infected with SARS-CoV-2 as described above; serum from COVID-19 patients and from a healthy control was used for PBMC experiments in a dilution of 1:32 in growth medium.
FcR inhibition
For the unspecific FcR inhibition experiments, culture medium was enriched with additional 10% FCS (Gibco/ThermoFisher Scientific, Dreieich, Germany) and cells were incubated overnight before infection.
To determine the impact of different FcγRs, PBMC-derived monocytes from each patient sample were incubated individually with 23 µg of monoclonal antibody (mAb) directed against FcγRI (CD64) or FcγRIIa (CD32A). After gentle mixing, PBMC-derived monocytes from each patient sample were incubated separately with the above-mentioned antibodies at room temperature for 10 min. Subsequently, PBMC-derived monocytes were seeded in 24-well microtiter plates at a density of 200,000 cells per well followed by steps as described above.
Genesig SARS-CoV-2 RT-qPCR
24 h post infectionem PBMC-derived monocytes were resuspended in 200 µL PBS (Merck, Darmstadt, Germany) and mixed with an equal volume of ATL buffer (Qiagen; Hilden, Germany) and incubated for 10 min at 56 °C for inactivation. Afterwards, RNA from 200 µL of the mixture was isolated on the MagnaPure96 platform (Roche, Basel, Switzerland) using the DNA/Viral NA SV 2.0 kit (Roche, Basel, Switzerland) with an elution volume of 100 µL. For SARS-CoV-2 detection, 8 µL of the RNA was used in the Genesig® COVID-19 Real-Time PCR assay (Primerdesign, Chandler's Ford, UK) that detects in 45 cycles orf1 ab genome region according to the manufacturer's instructions.
Subgenomic RT-qPCR (sgRNA RT-qPCR)
Virus replication was assessed by performing subgenomic (sg) RT-qPCR as described by Wölfel et al. (2020) with slight modifications. Primers and probes used were sgLeadSARSCoV2-F: CGATCTCTTGTAGATCTGTTCTC [33]; E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCGBBQ [34], E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA [34]. The forward primer binds a region in the leader sequence (5′-UTR) of SARS-CoV-2 while probe and reverse primer target sequences downstream of the E gene's start codon [33]. The sgRNA RT-PCR assay was carried out using the Superscript III one-step RT-PCR system with Platinum Taq Polymerase according to the manufacturer (Invitrogen, Darmstadt, Germany) and 400 nM of each primer, 200 nM of probe, 0.8 mM MgCl2 in a total volume of 25 µL of RNAse-free water. For reverse transcription and quantitative real-time PCR (RT-qPCR), a LightCycler 480 II (Roche, Basel, Switzerland) was used. RT-qPCR was performed with a temperature ramp rate of 4.4 °C/s unless stated otherwise. Reverse transcription was performed at 50 °C for 10 min, followed by denaturation for 3 min at 95 °C and 45 cycles of 15 s at 95 °C, 15 s at 56 °C with a ramp rate of 2.2 °C/s, and 5 s at 72 °C with subsequent data acquisition at 465–510 nm.
Determination of interleukin-6 (IL-6)
Cell culture supernatants were collected at 24 h post infectionem and secretion of IL-6 was measured using the Human IL-6 DuoSet ELISA from R&D SYSTEMS® (Minneapolis, Minnesota, USA) as recommended by the manufacturer. Supernatants were diluted 3:10 with reagent buffer from the ELISA kit. Each measurement was performed in technical duplicates and biological triplicates in a microplate reader (BioTeK EPOCH2, Agilent, Santa Clara, CA, USA) at a wavelength of 450 nm. The quantifiable measuring range of the test is 9.4–600 pg mL−1.
Quantitative measurement of IgG1 and IgG2 in serum
IgG1 and IgG2 serum concentrations were measured individually in each donor sample using the Optilite IgG1 and IgG2 kits, respectively, on the appropriate Optilite analyzer (The Binding Site Group Ltd., Birmingham, UK). Samples were not pooled.
Detection of the rs1801274 (A > G) polymorphism of FCGR2A
DNA from EDTA-anticoagulated (S-Monovette K3 EDTA, Sarstedt, Nümbrecht, Germany) blood derived from 18 COVID-19 patients with mild or severe symptoms and 18 blood donors without COVID-19 was extracted using the Qiagen Blood & Tissue Kit following the manufacturer's instructions. Primers for amplification of a 260 bp fragment of the rs1801274 region were Zau-CD32A-F01 5′-TGTGTCTTTCAGAATGGCTGGT-3′ and Zau-CD32A-R01 5′-AGTGATGGTCACAGGCTTGG-3′. PCR was performed as follows: 95 °C for 180 s, 35 repeats of 95 °C for 30 s, 60 °C for 15 s, 72 °C for 20 s, with subsequent final extension at 72 °C for 600 s. Sequencing was performed by Microsynth Seqlab GmbH (Göttingen, Germany).
Statistical analysis
For statistical analysis Welch's t-test was performed using the “stats.ttest_ind” function of the Python package SciPy v. 1.6.0 [35] with the equal_var setting set to false and using the standard “two-sided” alternative hypothesis setting.
For statistical analysis of the rs1801274 polymorphism a χ2 test was performed using the “stats.chisquare” function of the same package.
Plots were created using Matplotlib v 3.3.3 [36] and Seaborn v 0.11.1 [37].
Ethics statement
All donors gave written informed consent and use of human PBMCs was approved by the Ethics commission of the University Medical Center Göttingen (Project number 26/2/19).
Results
Opsonization of SARS-CoV-2 with antibodies from COVID-19 patients increases viral uptake and replication in monocytes.
This study aimed to identify the subtype of FcɣR that is involved in antibody-enhanced uptake of SARS-CoV-2 and its specific role in monocyte activation and COVID-19 pathogenesis. For this purpose, THP-1 cells and primary human monocytes enriched from PBMCs were used. RT-qPCR detection of SARS-CoV-2 revealed that co-incubation of a clinical isolate of SARS-CoV-2 (Goe18B6) with human serum from a patient with severe COVID-19 containing SARS-CoV-2-specific antibodies, increased the uptake of virions into THP-1 monocytes in a dose dependent manner (Fig. S1). Importantly, viral uptake into primary human PBMC-derived monocytes was significantly increased after incubation with SARS-CoV-2-positive serum (P < 0.05; Welch's t-test), but not after incubation with SARS-CoV-2 negative control serum (Fig. 1A). Viral replication in human monocytes was evidenced as indicated by sgRT-qPCR results that showed an increase in viral replication after SARS-CoV-2-specific serum antibody-mediated uptake of SARS-CoV-2 into primary human monocytes (Fig. 1B) in comparison to inoculation with virus without specific antibodies (P < 0.05; Fig. 1B).
Opsonization of SARS-CoV-2 with antibodies from COVID-19 patients increases viral uptake and replication in monocytes. (A) Primary human monocytes-enriched PBMCs (monocytes) were infected with SARS-CoV-2 that had been pre-treated with two dilutions (1:32; 1:64) of serum from a severe COVID-19 patient or serum derived from a healthy blood donor (control serum). SARS-CoV-2-specific RT-qPCR was performed on cells isolated 24 h post infection; non-infected cells were processed in parallel. Data shows threshold cycles (CT) of the PCR amplification; experiments were carried out in technical duplicates from three biological replicates each. (B) Monocytes enriched from PBMCs were infected with SARS-CoV-2 that had been pre-treated with COVID-19 serum or left untreated. SARS-CoV-2 subgenomic RT-qPCR was performed on cells isolated at 24 h post infection. Data are from three independent biological replicates and technical duplicates. n.d. = not detected; n.s. = not significant; * = P ≤ 0.05
Citation: European Journal of Microbiology and Immunology 14, 4; 10.1556/1886.2024.00109
FcγRIIa-mediated SARS-CoV-2 uptake into monocytes
In order to understand antibody-dependent SARS-CoV-2 uptake mechanistically, we first performed unspecific Fc receptor blocking experiments. Pre-incubation of PBMC-derived monocytes with FCS before addition of SARS-CoV-2 and SARS-CoV-2-specific antibodies diminished virus uptake into monocytes, suggesting that Fc receptors are involved in the antibody-mediated infection process of SARS-CoV-2 (Fig. 2A). Therefore, the impact of FcγRI and FcγRIIa in antibody-dependent uptake of SARS-CoV-2 was determined. Incubation of monocytes with anti-FcγRI (CD64) mAb prior to co-cultivation with SARS-CoV-2 opsonized with anti-SARS-CoV-2 human serum did not diminish viral load in PBMC-derived monocytes as compared to positive control cells (Fig. 2B), indicating no impact of this receptor on SARS-CoV-2 serum-dependent virus uptake by PBMC-derived monocytes. In contrast, pre-incubation of cells with anti-FcγRIIa mAb (CD32; clone IV.3) partially diminished enhanced uptake of SARS-CoV-2 virions mediated by COVID-19 serum (Fig. 2C). Since the MAb clone IV.3 is able to discriminate between the human inhibitory FcγRIIb and the activating FcγRIIa [38], our results thus indicate that FcγRIIa is partially responsible for the antibody-mediated uptake of SARS-CoV-2 by human monocytes.
FcγRIIa-mediated SARS-CoV-2 uptake into monocytes. (A) Human monocytes enriched from PBMCs (monocytes) were pre-incubated with medium supplemented with additional 10% FCS (i.e., containing 20% of FCS) or were left untreated as indicated. Cells were subsequently infected with SARS-CoV-2 that had been incubated with serum derived from a patient with severe COVID-19 (COVID-19 serum; dilution 1:32) or serum derived from a healthy blood donor (control serum). Monocytes infected with untreated SARS-CoV-2 were processed in parallel. SARS-CoV-2-specific RT-qPCR was performed on cells isolated 24 h post infectionem. Data show threshold cycles (CT) of the PCR amplification; experiments were carried out in technical duplicates from three biological replicates each; (B) Primary human monocytes were pretreated with a monoclonal antibody against the Fc binding site of FcɣRI prior to infection with antibody-opsonized (COVID-19 serum; dilution 1:32) or non-opsonized SARS-CoV-2 as indicated; non-infected monocytes were processed in parallel. Viral uptake into cells was determined by RT-qPCR as described above; (C) Likewise, monocytes were pretreated with monoclonal antibody against the binding site of FcγRIIa (clone IV.3) and subsequently infected with SARS-CoV-2 that had been pre-incubated with COVID-19 serum or negative control serum (dilution 1:32). Monocytes infected with untreated SARS-CoV-2 or non-infected monocytes pretreated with human-derived sera or anti-FcγRIIa were run in parallel. SARS-CoV-2 was detected by RT-qPCR as described above. n.d. = not detected; n.s. = not significant; * = P ≤ 0.05; ** = P ≤ 0.01; *** = P ≤ 0.001
Citation: European Journal of Microbiology and Immunology 14, 4; 10.1556/1886.2024.00109
Increased IL-6 production after pre-incubation of SARS-CoV-2 with COVID-19 serum
Here, we determined whether antibody-mediated viral infection of monocytes contributes to IL-6 production during COVID-19. Data shows that infection of monocytes with SARS-CoV-2 can lead to significant secretion of IL-6 (P < 0.0001) (Fig. 3). Importantly, co-incubation of SARS-CoV-2 with sera derived from severe COVID-19 patients prior to monocyte infection significantly increased IL-6 production (P = 0.0031) (Fig. 3). In contrast, human-derived control serum compared to mild COVID-19 sera (P = 0.132 and P = 0.39), or post-vaccination serum (P = 0.43) did not lead to a significant increase of IL-6 levels (Fig. 4). Neutralization assays revealed high levels of anti-SARS-CoV-2 neutralizing antibodies in sera from severe COVID-19 patients and in the post-vaccination serum, whereas serum from one out of two mild COVID-19 patients contained low level of neutralizing antibodies (Table 1). Human-derived sera from control individuals or COVID-19 patients alone did not induce detectable IL-6 secretion by monocytes (Fig. 3). Furthermore, sera from COVID-19 patients irrespective of disease severity, from control individuals and post-vaccination did not contain significant levels of IL-6. These results suggest that antibody-dependent monocyte infection with SARS-CoV-2 may contribute to the inflammatory response during COVID-19 (Fig. S2). Remarkably, blocking of FcγRIIa using mAb IV.3 revealed, that IL-6 elicited by virion-antibody complexes depends entirely on binding to this receptor subtype (Fig. 4).
Human IL-6 secretion after infection of monocytes with SARS-CoV-2 co-incubated with sera from mild and severe COVID-19 patients. Monocyte-enriched PBMCs were infected with SARS-CoV-2 previously incubated with sera from patients with mild or severe COVID-19 disease, serum from a non-infected control or a post-vaccination serum (serum dilution 1:32). Non-infected monocytes or monocytes infected with SARS-CoV-2 without prior serum incubation were tested in parallel. Twenty-four hours after infection, supernatants were assayed for IL-6 concentrations. IL-6 data is from three independent experiments with ELISA measurements being performed in technical duplicates. n.s. = not significant; * = P ≤ 0.05; ** = P ≤ 0.01
Citation: European Journal of Microbiology and Immunology 14, 4; 10.1556/1886.2024.00109
IL-6 secretion after antibody-dependent SARS-CoV-2 uptake by monocytes is mediated by FcγRIIa. Monocytes-enriched PBMCs were pretreated with anti-FcγRIIa (clone IV.3) or were left untreated. They were subsequently infected with SARS-CoV-2 that had been pre-incubated with serum from a severe COVID-19 patient or serum from a healthy control (dilution 1:32) as indicated. Monocytes infected with untreated SARS-CoV-2 or non-infected monocytes pretreated or not with human sera or anti-FcγRIIa were cultivated in parallel. Supernatants were collected 24 h after infection, and IL-6 levels were measured by ELISA. Data are from three independent experiments with ELISA measurements performed in technical duplicates. ** = P ≤ 0.01
Citation: European Journal of Microbiology and Immunology 14, 4; 10.1556/1886.2024.00109
IgG1 and IgG2 serum concentrations in COVID-19 patients and control individuals
| Severe COVID-19 patients | Mild COVID-19 patients | Blood donors | |
| Number of samples | 27 | 24 | 42 |
| Patient age (average) | |||
| Mean (SD) | 71.2 (14.8) | 52.7 (18.4) | n.a. |
| Median (IQR) | 71.0 (66.5, 75.0) | 57.0 (39.8, 61.0) | n.a. |
| IgG1 concentration [mg L−1] | |||
| Mean (SD) | 5.96 (2.29) | 4.96 (1.39) | 4.80 (1.68) |
| Median (IQR) | 5.88 (4.42, 7.31) | 5.21 (3.73, 5.85) | 4.24 (3.64, 5.59) |
| IgG2 concentration [mg L−1] | |||
| Mean (SD) | 2.80 (1.22) | 3.30 (1.40) | 2.74 (1.00) |
| Median (IQR) | 2.66 (2.21, 3.10) | 3.06 (2.27, 3.80) | 2.54 (2.15, 3.22) |
1SD = standard deviation. IQR = interquartile range; n.a. = not available; reference value for adults IgG1 concentration 2.8–8.0 mg L−1; reference value IgG2 concentration 1.15–5.70 mg L−1; IgG1 serum concentrations in patients with severe COVID -19 (P = 0.031).
Role of FcγRIIa and serum IgG1 and IgG2 during COVID-19
Since FcγRI does not contribute to antibody-dependent increased uptake of SARS-CoV-2 into monocyte-enriched PBMCs (see above), and since FcγRIIa strongly binds IgG1 and IgG2 immune complexes [39, 40], IgG1 and IgG2 serum concentrations were determined in clinical serum samples. To this end, sera from healthy blood donors obtained in 2018, i.e., without exposure to SARS-CoV-2 were compared with sera from patients with mild and severe COVID-19 (Table 1). Remarkably, IgG1 serum concentrations were significantly elevated (P = 0.031) in patients with severe but not in those with mild COVID-19, as compared to control sera. In contrast, IgG2 serum levels did not significantly differ between COVID-19 sera and control sera. However, a trend towards higher IgG2 levels was recognized in patients with mild COVID-19 symptoms as compared to those with severe COVID-19 and control individuals (Fig. 5).
Sera from patients with mild and severe COVID-19 show distinct IgG1 and IgG2 serum profiles. Total IgG1 (A) and IgG2 (B) concentrations were measured in sera obtained from COVID-19 patients with mild or severe disease and were compared to those from healthy blood donors without SARS-CoV-2 infection. * = P ≤ 0.05
Citation: European Journal of Microbiology and Immunology 14, 4; 10.1556/1886.2024.00109
An allelic variant of the FcγRIIa receptor gene FCGR2A, rs1801274 (A>G) results in a lower affinity for IgG1 and particularly IgG2 and reduced effector function due to an amino acid substitution from histidine to arginine at position 131 (H131R) in the second Ig-like domain of FcγRIIa [22, 41]. Thus, FcγRIIa genotypes were compared between healthy blood donors and COVID-19 patients with mild and severe symptoms, using EDTA-anticoagulated blood samples. Results showed a trend towards higher frequency of homozygosity of the rs1801274 G allele encoding R/R at amino acid 131 among COVID-19 patients (37.5%) than among healthy blood donors (22.2%; χ2 P = 0.14; Fig. 6). This suggests less intense downstream effects particularly of IgG2 binding to the FcγRIIa receptor. Of note, FCGR2A rs1801274 A homozygosity (H/H) was not detected.
Frequency of FCGR2A rs1801274 polymorphism differs between COVID-19 patients and healthy blood donors. Blood was obtained from 18 patients with mild or severe COVID-19 symptoms and from 18 healthy blood donors. Genomic DNA encompassing the rs1801274 polymorphism of the FCGR2A gene was amplified by PCR and sequenced. Data show frequencies of rs1801274 A/G (HR) heterozygosity and rs1801274 G/G (RR) homozygosity among both groups
Citation: European Journal of Microbiology and Immunology 14, 4; 10.1556/1886.2024.00109
Discussion
During infections with several viruses, including dengue virus (DENV), SARS-CoV, and MERS-CoV (middle east respiratory syndrome corona virus), host antibodies can exacerbate the course of disease, a pathogenic mechanism termed antibody-dependent enhancement (ADE) [24, 42, 43]. In this study, we present evidence that ADE may also occur during COVID-19. Monocytes express high levels of FcγRI and FcγRIIa receptors but only moderate levels of FcγRIIb, and only a monocyte subpopulation expresses FcγRIII [44–46]. Remarkably, whereas antibody-dependent viral uptake into monocytes was only partially mediated by FcγRIIa, IL-6 secretion following antibody-dependent viral uptake was entirely due to FcγRIIa engagement. We also show that significantly elevated serum levels of IgG1, the most abundant human IgG subclass [47, 48], are associated with COVID-19 severity. Finally, patients with manifest COVID-19 tend to express the R131/R131 variant of the FcγRIIa at higher frequency than COVID-19 negative controls, also suggesting a contribution of FcγRIIa polymorphism to COVID-19 pathogenesis.
Several mechanisms have been proposed to contribute to ADE, i.e. enhanced infection of host cells after binding of antibody-virion complexes to FcγRs, increased immunopathology due to Fc-dependent effector functions and immune complex deposition [49], and antibody binding to the spike (S) protein leading to increased binding capacity of SARS-CoV-2 to ACE2 and enhanced infection [50–52]. Our in vitro data indicate an enhanced infection mechanism that at least during the first 24 h of infection leads to increased viral replication in monocytes, as shown by diagnostic and subgenomic RT-PCR. SARS-CoV-2 can be taken up into several human cell lines in an antibody-dependent and FcγR-mediated manner [50, 52]. We extend these previous findings, showing that also THP-1 monocytes and, importantly, primary human monocytes can be infected by authentic SARS-CoV-2 after incubation with serum from severely affected COVID-19 patients. This is not in accordance with the previous report of García-Nicolás et al. [53] where sera from COVID-19 convalescent patients were used and no ADE effect on monocytes could be shown. Our data however are in line with a report on the efficient infection and replication of non-infectious virus particles of SARS-CoV-2 in CD14+ monocytes in vitro and in vivo [26, 54]. Further, virus replication in monocytes and macrophages was also reported in case of SARS and MERS coronaviruses [55, 56], dengue virus infection [57, 58], and it has at least been debated for SARS-CoV-2 [59]. However, we cannot currently exclude the possibility that infection of human monocytes is abortive at later stages [60].
Antibody-dependent viral uptake into human monocytes was only partially inhibited by blocking the FcγRIIa. Since blocking the FcγRI had no effect, and since an unspecific Fc block also only partially inhibited viral uptake, we propose that antibody binding to the SARS-CoV-2 S protein contributes to ADE. Some antibodies isolated from COVID-19 patients bind to the N-terminal domain of the S protein, thereby inducing an open conformation of the receptor-binding domain that facilitates ACE2-binding and host cell infection [51, 52]. Thus, FcγRIIa-dependent and -independent mechanisms may contribute to ADE of monocyte infection. Nevertheless, previous work excluded a role of ACE2 expressed on monocytes regarding ADE [26].
Antibody-dependent SARS-CoV-2 uptake into monocytes was accompanied by a strong increase in IL-6 secretion. High IL-6 plasma concentrations mostly correlate with severe COVID-19 illness and infection outcome [61–64], and IL-6 appears also to be up-regulated in bronchoalveolar lavage fluid during COVID-19 [65] and in lung tissue from deceased patients [66]. Our data indicate that activation of monocytes by antibody-virion complexes contributes considerably to the increase in IL-6 levels during COVID-19. Furthermore, this activation depends on binding of the opsonized virions to FcγRIIa, as receptor blocking abrogated the increased IL-6 secretion. This finding is in line with FcγRIIa harboring an immunoreceptor tyrosine activating motif (ITAM) on its intracellular domain which, after receptor ligation, leads to activation of several signaling pathways and expression of pro-inflammatory cytokines [19].
In this study we also provide clinical data that are consistent with a role of ADE in the pathogenesis of COVID-19. Serum samples from patients with severe course of disease but not from those with mild disease contained significantly elevated levels of IgG1 but not IgG2. IgG1 accounts for ∼60% of all serum IgGs [48] and IgG1 immune complexes bind strongly to FcγRIIa [22]. Thus, increased IgG1 during COVID-19 may contribute to more efficient uptake of SARS-CoV-2 into monocytes and lead to efficient and possibly detrimental triggering of IL-6 release [63, 64]. COVID-19 patients also more frequently presented the homozygous FcγRIIa R131 variant, although this did not reach statistical significance. The FcγRIIa R131 allotype binds IgG2 antibodies less efficiently than the H131 allotype [22] and it has been linked to higher prevalences of autoimmune disorders and bacterial infections [67–69]. A recent study demonstrated that the FCGR2A rs1801274 G allele (R131) was significantly associated with a lethal COVID-19 outcome [70]. Whether and how it contributes to COVID-19 pathogenesis awaits further investigation.
Conclusion
This study leads to the conclusion that FcγRIIa appears to play role in the progression of COVID-19. Since FcγRIIa is known as a receptor facilitate ADE and activate platelet function, a potential connection between the progression of severe COVID-19 and the formation of microthrombi should be investigated further. Previous research has reported that mutations of FcγRIIa exhibit lower affinity for IgG2 and are associated with more complicated bacterial infections. Therefore, investigating the interplay of these known low-affinity mutations of FcγRIIa with the virus during infections is essential for a better understanding of the pathogenicity of SARS-CoV-2 infection. Screening of genomic FcγRIIa DNA from blood samples of both healthy donors and patients with severe COVID-19 revealed a tendency towards a higher frequency of rs1801274 mutations in the latter group.
Funding source
No financial support was received for this study.
Authors' contributions
Conceptualization, Kemal Mese, Oskar Bunz, Jian Gao, Andreas E. Zautner and Uwe Groß; Data curation, Ahmed Sayed Abdel-Moneim, Esther Maguilla Rosado, Patrick Jordan, Raimond Lugert, Wolfgang Bohne, Anna Dudakova and Andreas E. Zautner; Formal analysis, Kemal Mese and Uwe Groß; Funding acquisition, Andreas E. Zautner and Uwe Groß; Investigation, Kemal Mese and Esther Maguilla Rosado; Methodology, Kemal Mese, Esther Maguilla Rosado, Patrick Jordan and Carsten G. K. Lüder; Project administration, Kemal Mese; Resources, Kemal Mese and Uwe Groß; Software, Julian Schwanbeck; Supervision, Carsten G. K. Lüder and Uwe Groß; Visualization, Kemal Mese and Julian Schwanbeck; Writing – original draft, Kemal Mese, Patrick Jordan, Carsten G. K. Lüder, Oskar Bunz, Jian Gao and Andreas E. Zautner. All authors have read and agreed to the published version of the manuscript.
Conflict of interests
The authors declare no conflict of interest.
Declaration of competing interest
All authors declare no competing interests. This research received no external funding.
Supplementary material
Supplementary data to this article can be found online at https://doi.org/10.1556/1886.2024.00109.
Acknowledgments
Special thanks to Svenja Schiegl, Sandra Götze and Safet Pepic for performing RT-qPCR and measuring the IgG1/2 serum concentration. Thanks to Melanie Eisele for supplying cultured PBMCs and thanks to Martin Winkler for collecting the sera.
References
- 1.↑
Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. The lancet. 2020;395(10223):497–506.
- 3.↑
Zhu N, Zhang D, Wang W, Li X, Yang B, Song J, et al. China novel coronavirus investigating and research team. A novel coronavirus from patients with pneumonia in China, 2019. N Engl J Med. 2020;382(8):727–33.
- 4.↑
Cheng VC, Lau SK, Woo PC, Yuen KY. Severe acute respiratory syndrome coronavirus as an agent of emerging and reemerging infection. Clin Microbiol Rev. 2007;20(4):660–94.
- 6.↑
Chu DK, Pan Y, Cheng SM, Hui KP, Krishnan P, Liu Y, et al. Molecular diagnosis of a novel coronavirus (2019-nCoV) causing an outbreak of pneumonia. Clin Chem. 2020;66(4):549–55.
- 7.↑
Wu F, Zhao S, Yu B, Chen Y-M, Wang W, Song Z-G, et al. A new coronavirus associated with human respiratory disease in China. Nature. 2020;579(7798):265–9.
- 8.↑
Zhou F, Yu T, Du R, Fan G, Liu Y, Liu Z, et al. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study. The lancet. 2020.
- 9.↑
Ge X-Y, Li J-L, Yang X-L, Chmura AA, Zhu G, Epstein JH, et al. Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature. 2013;503(7477):535–8.
- 10.↑
Liu Z, Xiao X, Wei X, Li J, Yang J, Tan H, et al. Composition and divergence of coronavirus spike proteins and host ACE2 receptors predict potential intermediate hosts of SARS‐CoV‐2. J Med Virol. 2020;92(6):595–601.
- 11.↑
Corti D, Lanzavecchia A. Broadly neutralizing antiviral antibodies. Annu Rev Immunol. 2013;31(1):705–42.
- 12.↑
VanBlargan LA, Goo L, Pierson TC. Deconstructing the antiviral neutralizing-antibody response: implications for vaccine development and immunity. Microbiol Mol Biol Rev. 2016;80(4):989–1010.
- 13.↑
Walker LM, Burton DR. Passive immunotherapy of viral infections:'super-antibodies' enter the fray. Nat Rev Immunol. 2018;18(5):297–308.
- 14.↑
Sedova E, Scherbinin D, Lysenko A, Alekseeva S, Artemova E, Shmarov M. Non-neutralizing antibodies directed at conservative influenza antigens. Acta Naturae (англоязычная версия). 2019;11(4 (43)):22–32.
- 15.↑
Hawkes R, Lafferty K. The enhancement of virus infectivity by antibody. Virology. 1967;33(2):250–61.
- 17.↑
Furuyama W, Nanbo A, Maruyama J, Marzi A, Takada A. A complement component C1q-mediated mechanism of antibody-dependent enhancement of Ebola virus infection. PLoS Negl Trop Dis. 2020;14(9):e0008602.
- 18.↑
Elfessi Z, Doyle R, Young L, Knaub M, Yamanaka T. Antibody dependent enhancement-induced hypoxic respiratory failure: a case report. Vis J Emerg Med. 2023;30:101602.
- 19.↑
Bournazos S, Gupta A, Ravetch JV. The role of IgG Fc receptors in antibody-dependent enhancement. Nat Rev Immunol. 2020;20(10):633–43.
- 20.↑
Clark MR, Clarkson SB, Ory PA, Stollman N, Goldstein I. Molecular basis for a polymorphism involving Fc receptor II on human monocytes. The J Immunol. 1989;143(5):1731–4.
- 21.↑
Warmerdam P, Van de Winkel J, Vlug A, Westerdaal N, Capel P. A single amino acid in the second Ig-like domain of the human Fc gamma receptor II is critical for human IgG2 binding. The J Immunol. 1991;147(4):1338–43.
- 22.↑
Bruhns P, Iannascoli B, England P, Mancardi DA, Fernandez N, Jorieux S, et al. Specificity and affinity of human Fcγ receptors and their polymorphic variants for human IgG subclasses. Blood. 2009;113(16):3716–25.
- 23.↑
Brown MG, King CA, Sherren C, Marshall JS, Anderson R. A dominant role for FcγRII in antibody‐enhanced dengue virus infection of human mast cells and associated CCL5 release. J Leukoc Biol. 2006;80(6):1242–50.
- 24.↑
Halstead S, O'rourke E. Dengue viruses and mononuclear phagocytes. I. Infection enhancement by non-neutralizing antibody. The J Exp Med. 1977;146(1):201–17.
- 25.↑
Wu F, Yan R, Liu M, Liu Z, Wang Y, Luan D, et al. Antibody-dependent enhancement (ADE) of SARS-CoV-2 infection in recovered COVID-19 patients: studies based on cellular and structural biology analysis. medRxiv. 2020.
- 26.↑
Junqueira C, Crespo Â, Ranjbar S, de Lacerda LB, Lewandrowski M, Ingber J, et al. FcγR-mediated SARS-CoV-2 infection of monocytes activates inflammation. Nature. 2022:1–13.
- 27.↑
Selvaraj P, Rosse WF, Silber R, Springer TA. The major Fc receptor in blood has a phosphatidylinositol anchor and is deficient in paroxysmal nocturnal haemoglobinuria. Nature. 1988;333(6173):565–7.
- 28.↑
Liu Y, Ning Z, Chen Y, Guo M, Liu Y, Gali NK, et al. Aerodynamic analysis of SARS-CoV-2 in two Wuhan hospitals. Nature. 2020;582(7813):557–60.
- 30.↑
DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011;43(5):491.
- 31.↑
Dörschug A, Schwanbeck J, Hahn A, Hillebrecht A, Blaschke S, Mese K, et al. Comparison of five serological assays for the detection of SARS-CoV-2 antibodies. Diagnostics. 2021;11(1):78.
- 32.↑
Münsterkötter L, Hollstein MM, Hahn A, Kröger A, Schnelle M, Erpenbeck L, et al. Comparison of the anti-SARS-CoV-2 surrogate neutralization assays by TECOmedical and DiaPROPH-med with samples from vaccinated and infected individuals. Viruses. 2022;14(2):315.
- 33.↑
Wölfel R, Corman VM, Guggemos W, Seilmaier M, Zange S, Müller MA, et al. Virological assessment of hospitalized patients with COVID-2019. Nature. 2020;581(7809):465–9.
- 34.↑
Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK, et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance. 2020;25(3):2000045.
- 35.↑
Virtanen P, Gommers R, Oliphant TE, Haberland M, Reddy T, Cournapeau D, et al. SciPy 1.0: fundamental algorithms for scientific computing in Python. Nat Methods. 2020;17(3):261–72.
- 37.↑
Waskom M, Botvinnik O, O’Kane D, Hobson P, Lukauskas S, Gemperline D, et al. Mwaskom/seaborn. 0.8; 2017.
- 38.↑
Veri MC, Gorlatov S, Li H, Burke S, Johnson S, Stavenhagen J, et al. Monoclonal antibodies capable of discriminating the human inhibitory Fcγ‐receptor IIB (CD32B) from the activating Fcγ‐receptor IIA (CD32A): biochemical, biological and functional characterization. Immunology. 2007;121(3):392–404.
- 39.↑
Parren P, Warmerdam P, Boeije L, Arts J, Westerdaal N, Vlug A, et al. On the interaction of IgG subclasses with the low affinity Fc gamma RIIa (CD32) on human monocytes, neutrophils, and platelets. Analysis of a functional polymorphism to human IgG2. The J Clin Invest. 1992;90(4):1537–46.
- 40.↑
Chen X, Song X, Li K, Zhang T. FcγR-binding is an important functional attribute for immune checkpoint antibodies in cancer immunotherapy. Front Immunol. 2019;10:292.
- 41.↑
Armour KL, van de Winkel JG, Williamson LM, Clark MR. Differential binding to human FcγRIIa and FcγRIIb receptors by human IgG wildtype and mutant antibodies. Mol Immunol. 2003;40(9):585–93.
- 42.↑
Yip MS, Leung NHL, Cheung CY, Li PH, Lee HHY, Daëron M, et al. Antibody-dependent infection of human macrophages by severe acute respiratory syndrome coronavirus. Virol J. 2014;11(1):1–11.
- 43.↑
Wan Y, Shang J, Sun S, Tai W, Chen J, Geng Q, et al. Molecular mechanism for antibody-dependent enhancement of coronavirus entry. J Virol. 2020;94(5).
- 44.↑
Fleit HB, Kobasiuk CD. The human monocyte‐like cell line THP‐1 expresses FcγRI and FCγRII. J Leukoc Biol. 1991;49(6):556–65.
- 45.↑
Guilliams M, Bruhns P, Saeys Y, Hammad H, Lambrecht BN. The function of Fcγ receptors in dendritic cells and macrophages. Nat Rev Immunol. 2014;14(2):94–108.
- 46.↑
Vogelpoel LT, Baeten DL, de Jong EC, Den Dunnen J. Control of cytokine production by human fc gamma receptors: implications for pathogen defense and autoimmunity. Front Immunol. 2015;6:79.
- 47.↑
French MA, Harrison G. Serum IgG subclass concentrations in healthy adults: a study using monoclonal antisera. Clin Exp Immunol. 1984;56(2):473–5.
- 48.↑
Vidarsson G, Dekkers G, Rispens T. IgG subclasses and allotypes: from structure to effector functions. Front Immunol. 2014;5:520.
- 49.↑
Lee WS, Wheatley AK, Kent SJ, DeKosky BJ. Antibody-dependent enhancement and SARS-CoV-2 vaccines and therapies. Nat Microbiol. 2020;5(10):1185–91.
- 50.↑
Zhou Y, Liu Z, Li S, Xu W, Zhang Q, Silva IT, et al. Enhancement versus neutralization by SARS-CoV-2 antibodies from a convalescent donor associates with distinct epitopes on the RBD. Cell Rep. 2021;34(5):108699.
- 51.↑
Liu Y, Soh WT, Kishikawa JI, Hirose M, Nakayama EE, Li S, et al. An infectivity-enhancing site on the SARS-CoV-2 spike protein targeted by antibodies. Cell. 2021;184(13):3452–66 e18.
- 52.↑
Li D, Edwards RJ, Manne K, Martinez DR, Schafer A, Alam SM, et al. In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. Cell. 2021;184(16):4203–19 e32.
- 53.↑
García-Nicolás O, V’kovski P, Zettl F, Zimmer G, Thiel V, Summerfield A. No evidence for human monocyte-derived macrophage infection and antibody-mediated enhancement of SARS-CoV-2 infection. Front Cell Infect Microbiol. 2021;11:248.
- 54.↑
Pontelli MC, Castro IA, Martins RB, Veras FP, Serra L, Nascimento DC, et al. Infection of human lymphomononuclear cells by SARS-CoV-2. bioRxiv. 2020.
- 55.↑
Chu H, Zhou J, Wong BH-Y, Li C, Cheng Z-S, Lin X, et al. Productive replication of Middle East respiratory syndrome coronavirus in monocyte-derived dendritic cells modulates innate immune response. Virology. 2014;454:197–205.
- 56.↑
Yilla M, Harcourt BH, Hickman CJ, McGrew M, Tamin A, Goldsmith CS, et al. SARS-coronavirus replication in human peripheral monocytes/macrophages. Virus Res. 2005;107(1):93–101.
- 57.↑
Wang W-K, Sung T-L, Tsai Y-C, Kao C-L, Chang S-M, King C-C. Detection of dengue virus replication in peripheral blood mononuclear cells from dengue virus type 2-infected patients by a reverse transcription-real-time PCR assay. J Clin Microbiol. 2002;40(12):4472–8.
- 58.↑
Durbin AP, Vargas MJ, Wanionek K, Hammond SN, Gordon A, Rocha C, et al. Phenotyping of peripheral blood mononuclear cells during acute dengue illness demonstrates infection and increased activation of monocytes in severe cases compared to classic dengue fever. Virology. 2008;376(2):429–35.
- 59.↑
Osuchowski MF, Winkler MS, Skirecki T, Cajander S, Shankar-Hari M, Lachmann G, et al. The COVID-19 puzzle: deciphering pathophysiology and phenotypes of a new disease entity. The Lancet Respir Med. 2021.
- 60.↑
Boumaza A, Gay L, Mezouar S, Bestion E, Diallo AB, Michel M, et al. Monocytes and macrophages, targets of severe acute respiratory syndrome coronavirus 2: the clue for coronavirus disease 2019 immunoparalysis. J Infect Dis. 2021;224(3):395–406.
- 61.↑
Chen X, Zhao B, Qu Y, Chen Y, Xiong J, Feng Y, et al. Detectable serum severe acute respiratory syndrome coronavirus 2 viral load (RNAemia) is closely correlated with drastically elevated interleukin 6 level in critically ill patients with coronavirus disease 2019. Clin Infect Dis. 2020;71(8):1937–42.
- 62.↑
Gao Y, Li T, Han M, Li X, Wu D, Xu Y, et al. Diagnostic utility of clinical laboratory data determinations for patients with the severe COVID‐19. J Med Virol. 2020;92(7):791–6.
- 63.↑
Zawawi A, Naser AY, Alwafi H, Minshawi F. Profile of circulatory cytokines and chemokines in human coronaviruses: a systematic review and meta-analysis. Front Immunol. 2021;12:666223.
- 64.↑
Ramasamy S, Subbian S. Critical determinants of cytokine storm and type I interferon response in COVID-19 pathogenesis. Clin Microbiol Rev. 2021;34(3).
- 65.↑
Carvelli J, Demaria O, Vely F, Batista L, Chouaki Benmansour N, Fares J, et al. Association of COVID-19 inflammation with activation of the C5a-C5aR1 axis. Nature. 2020;588(7836):146–50.
- 66.↑
Ackermann M, Verleden SE, Kuehnel M, Haverich A, Welte T, Laenger F, et al. Pulmonary vascular endothelialitis, thrombosis, and angiogenesis in Covid-19. N Engl J Med. 2020;383(2):120–8.
- 67.↑
Haseley LA, Wisnieski JJ, Denburg MR, Michael-Grossman AR, Ginzler EM, Gourley MF, et al. Antibodies to C1q in systemic lupus erythematosus: characteristics and relation to Fc gamma RIIA alleles. Kidney Int. 1997;52(5):1375–80.
- 68.↑
Sanders LA, van de Winkel JG, Rijkers GT, Voorhorst-Ogink MM, de Haas M, Capel PJ, et al. Fc gamma receptor IIa (CD32) heterogeneity in patients with recurrent bacterial respiratory tract infections. J Infect Dis. 1994;170(4):854–61.
- 69.↑
Duits AJ, Bootsma H, Derksen RH, Spronk PE, Kater L, Kallenberg CG, et al. Skewed distribution of IgG Fc receptor IIa (CD32) polymorphism is associated with renal disease in systemic lupus erythematosus patients. Arthritis Rheum. 1995;38(12):1832–6.
- 70.↑
López-Martínez R, Albaiceta GM, Amado-Rodríguez L, Cuesta-Llavona E, Gómez J, García-Clemente M, et al. The FCGR2A rs1801274 polymorphism was associated with the risk of death among COVID-19 patients. Clin Immunol. 2022;236:108954.
