Mice

Full body Acsbg1 knock out mice (B6-Acsbg1^{tm1a(Eu-comm)Hmgu} mice) were generated from embryonic stem cells harboring the tm1a construct within the Acsbg1 locus, obtained from Eucomm [29, 30]. All mice used in this study (B6-Acsbg1^{tm1a(Eu-comm)Hmgu}, B6; hybrid-Rag2^tm1Cgn (Rag2^−/−)) were bred and maintained at the Helmholtz Centre for Infection Research (Braunschweig, Germany), which provides state-of-the-art laboratory animal care and service. All mice were housed under specific opportunistic and pathogen-free conditions (SOPF) in isolated, ventilated cages, and handled by personnel appropriately trained as well as dedicated animal care staff to assure the highest possible hygienic standards and animal welfare in compliance with German and European animal welfare guidelines. For all experiments, heterozygous Acsbg1^+/− mice were bred to obtain Acsbg1^−/− mice and Acsbg1^+/+ littermate controls. Before experimental use, all mice were genotyped by subjecting genomic DNA to PCR testing for the integrity of intron 2 (F: 5′-GTCTTTGCACCCAGGCTC; R: 5′-GCTTCCATGCTTGCTGCTAC) and for the presence of the ‘tm1a’ construct (F: 5′- GTCTTTGCACCCAGGCTC; R: 5′-GTGGGAAAGGGTTCGAAGTT).

Cell isolation from organs

To prepare single-cell suspensions from lymphoid organs, mice were sacrificed by CO₂ asphyxiation. The spleens were isolated and mechanically disrupted using a plunger and phosphate-buffered saline (PBS, Gibco, Schwerte, Germany) containing 0.2% bovine serum albumin (BSA, Merck, Darmstadt, Germany). Cell suspensions were filtered through a nylon mesh with a pore size of 100 μm. Subsequently, the cell suspensions were washed and splenocytes underwent erythrocyte lysis (0.01 M potassium bicarbonate, 0.155 M ammonium chloride, and 0.1 mM ethylenediaminetetraacetic acid (EDTA), all from Sigma-Aldrich, Hamburg, Germany, at pH 7.5). Following an additional washing step, cell suspensions were filtered through a 30 μm nylon mesh. For the preparation of colonic single-cell suspensions, colons were opened longitudinally and washed with pre-digestion medium (PBS, containing 0.2% BSA and 5 mM EDTA) to remove feces. Subsequently, colons were incubated with pre-digestion medium at 37 °C three times for 15 min with a magnetic stirrer (250–300 rpm). After washing with PBS, pre-digested colons were cut into 1–2 mm pieces and digested in Hanks' balanced salt solution (HBSS) (with Mg²⁺ and Ca²⁺; Gibco) containing 1 mg mL⁻¹ Collagenase D (Roche, Penzberg, Germany), 100 μg mL⁻¹ DNaseI (Roche), and 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco) at 37 °C for 1 h with a magnetic stirrer. Subsequently, cells were subjected to 40%/80% Percoll (GE Healthcare, Braunschweig, Germany) gradient centrifugation (780 g, room temperature, 20 min, acceleration and brake off). Cells from the interphase layer were collected, washed, and resuspended in PBS supplemented with 0.2% BSA.

Antibodies, flow cytometry and cell sorting

Flow cytometric analysis was performed as described recently [31]. Viability staining was carried out in PBS using the LIVE/DEAD™ Fixable Blue Dead Cell Stain Kit (Invitrogen, Langenselbold, Germany) in accordance with the manufacturer's instructions. Surface staining was performed for 15 min on ice in PBS containing 0.2% BSA. Unconjugated anti-FcRγIII/II antibody (BioXcell, Eching, Germany; final concentration 10 μg mL⁻¹) was included in the staining mix to block Fc receptors. Intracellular staining was performed using the Foxp3/Transcription Factor Staining Buffer Set (eBioscience, Langenselbold, Germany) following the manufacturer's instructions. To prevent nonspecific antibody binding, 40 μg mL⁻¹ of rat IgG (Dianova, Hamburg, Germany) was used as a blocking agent. For intracellular cytokine staining, cells were stimulated with phorbol 12-myristate 13-acetate (PMA, 10 ng mL⁻¹), Ionomycin (0.5 μg mL⁻¹), and Brefeldin A (10 μg mL⁻¹) for 4 h at 37 °C (all from Sigma-Aldrich). After staining, cells were washed, resuspended in PBS supplemented with 0.2% BSA, and analyzed using a FACSymphony A5 SE flow cytometer (BD Biosciences, Heidelberg, Germany), with data processed using FlowJo software (FlowJo, Ashland, Oregon, USA). Living cell count was quantified on a MACSQuant Analyzer 10 Flow Cytometer (Miltenyi Biotec, Bergisch Gladbach, Germany).

For fluorescence-activated cell sorting (FACS), single-cell suspensions from the indicated organs were stained with specific antibodies, and Lin⁻ cells of interest (unless otherwise specified – Lin: CD8α, CD45R, CD19, CD11c, F4/80) were sorted using a BD FACSAria-II SORP, BD FACSAria-Fusion, or Symphony S6 SE (all from BD Biosciences).

In this study, cells were stained with the following fluorochrome-conjugated antibodies purchased from either BD Horizon (Heidelberg, Germany), BioLegend (Eching, Germany), or eBioscience: CD3ε (145-2C11), CD4 (GK1.5), CD8α (53-6.7), CD11c (N418), CD19 (6D5), CD25 (PC61), CD27 (LG.3A10), CD44 (IM7), CD45R (B220) (RA3-6B2), CD62L (MEL-14), CCR6 (140706), IL-10 (JES5-16E3), IL-17A (eBio17B7), IL-22 (Poly5164), IFN-γ (XMG1.2), F4/80 (BM8), Foxp3 (FJK-16S), NK1.1 (PK136), RORγt (Q31-378), T-bet (4B10), and ST2 (RMST2-2).

In vitro T_H cell differentiation assay

Single-cell suspensions were prepared from spleens of Acsbg1^−/− mice or Acsbg1^+/+ littermate controls as described above. Subsequently, FACS-sorted T_naïve cells (Lin⁻CD4⁺CD25⁻CD62L^high cells) were cultured in Iscove's Modified Dulbecco's Medium (IMDM) containing 10% fetal calf serum, 1 mM sodium pyruvate, 50 U mL⁻¹ penicillin and streptomycin, 25 mM HEPES, 50 μM β-mercaptoethanol, and nonessential amino acids (Thermo Fisher Scientific, Langenselbold, Germany; and Biochrom AG, Berlin, Germany), and 1 × 10⁵ cells per well were seeded into 96-well round-bottom plates together with 1 × 10⁵ Dynabeads Mouse T-Activator CD3/CD28 (Thermo Fisher Scientific). For polarization into different T_H cell subsets, the following cytokines and antibodies were added: T_H0 – non-polarizing control; in vitro-induced T_reg (iT_reg) – human transforming growth factor β1 (hTGF-β1) (5 ng mL⁻¹); T_H17 – IL-6 (30 ng mL⁻¹), hTGF-β1 (2 ng mL⁻¹), IL-1β (10 ng mL⁻¹), anti-IL-2 (5 μg mL⁻¹, JES6-1A12), anti-interferon-γ (IFN-γ) (10 μg mL⁻¹, XMG1.2); T_H1 – IL-12 (20 ng mL⁻¹), anti-IL-4 (10 ng mL⁻¹, 11B11) (all purchased from BioLegend and BioXCell, Eching, Germany; Peprotech, Hamburg, Germany; or R&D, Wiesbaden-Nordenstadt, Germany). In each experiment, technical triplicates for each sample and condition were prepared. After three days of cultivation, cells were split 1:1 and supplemented with: T_H0 and T_H1 – IL-2 (5 ng mL⁻¹, R&D); iT_reg – IL-2 (10 ng mL⁻¹); T_H17 – IL-23 (5 ng mL⁻¹, BioLegend). On day 4, cells were analyzed via flow cytometry as described above or harvested for RNA isolation and subsequent assessment of Acsbg1 expression.

Real time quantitative PCR

Acsbg1 expression was assessed in in vitro differentiated T_H cell subsets. RNA was isolated from cultured T cells using the RNeasy Plus Mini or Micro Kit (Qiagen, Hilden, Germany). Complementary DNA (cDNA) was generated from equivalent amounts of RNA using Transcriptor First Strand cDNA Synthesis Kit (Roche). For quantification, samples were amplified by real-time quantitative polymerase chain reaction (RT-qPCR) using SYBR Green (Roche). RT-qPCR was performed on a LightCycler®480 System (Roche). 5 µL of DNA template was mixed with 10 µL of LightCycler® 480 SYBR Green I Master (Roche), 10 pmol forward and reverse primers in a final volume of 20 μL. After amplification (95 °C for 5 min; 45 cycles: 95 °C for 10 s, 60 °C for 10 s, 72 °C for 10 s), the Ct value was defined by LightCycler®480 software with default settings. Ct values higher than 42 were considered as no expression. Relative messenger RNA (mRNA) expression was calculated by normalization to the expression of ribosomal protein S9 (Rps9). The following primer pairs were used: Rps9 (F: 5′- CTGGACGAGGGCAAGATGAAGC; R: 5′-TGACTGTGGCGGATGAGCACA); Acsbg1 (F: 5′- CCAAAGAGTCTCCAAGTCACG; R: 5′- GAGTACAGAAAGGTTCCAGGC); Acyl-Coenzyme A Synthetase Long Chain Family Member 6 (Acsl6) (F: 5′-CAGAGGAACTCAACTACTGGACC; R: 5′-CCAATGTCTCCAGTGTGAAGCC); Acyl-Coenzyme A Synthetase Long Chain Family Member 5 (Acsl5) (F: 5′-GCATCATTCGGCGGGACAGTTT; R: 5′-GTCAAGACTGGAGTGGAGATGG).

Adoptive transfer colitis

T_naïve cells were sorted by FACS as Lin⁻CD4⁺CD25⁻CD62L^high from single-cell suspensions of pooled spleens from 8-week-old Acsbg1^−/− mice or Acsbg1^+/+ littermate controls. Sorted cells were washed twice with PBS, and 3 × 10⁵ T_naïve cells were injected intraperitoneally in a volume of 100 μL PBS into sex-matched 8 to 10-week-old Rag2^−/− recipient mice. Rag2^−/− mice injected with only 100 μL PBS served as controls. The body weight and health status of recipient mice were monitored over the course of 8 weeks according to the animal license number 33.19-42502-04-20/3540. At the end of the experiment, mice were sacrificed by CO₂ asphyxiation, and either the colon was analyzed by histology or single-cell suspensions from the colon were prepared for flow cytometry.

Histological analyses

Colons and small intestines were collected, weighted and their length was measured. The weight-to-length ratio (mg cm⁻¹) was calculated by dividing the organ weight by its length. The samples were arranged into a ‘Swiss roll’ configuration, fixed in 4% neutrally buffered formaldehyde, and embedded in paraffin using standard histological procedures. Sections approximately 3 μm thick were stained with hematoxylin and eosin (H&E) and analyzed under a light microscope. The evaluation was conducted in a randomized and blinded manner. The severity of inflammation was assessed using a histological scoring system adapted from the Jackson Laboratory score developed for scoring colitis in mice [32].

Software

Flow cytometric samples were acquired by BD FACS Diva Software (Heidelberg, Germany). Flow cytometric data were analyzed by FlowJo® 10.10.0 and Microsoft Excel 2024 (Microsoft Corporation, Munich, Germany), and graphs were produced by GraphPad Prism 10.4.1 (GrapPad Software, Boston, MA, USA). Endnote X9 (Clarivate Analytics, Philadelphia, PA, USA) was used for reference management.

Statistical analysis

Statistical analyses were performed using GraphPad Prism (v10.4.1). If not stated otherwise, data were presented as mean ± SEM. Comparisons between groups were made using two-way ANOVA with Šidák's or Tukey's multiple comparison tests, or the Mann-Whitney U test where applicable. Survival data were analyzed using the Kaplan-Meier method and Log-Rank (Mantel-Cox) test. A P-value below 0.05 was considered significant; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. Specific details for each analysis are provided in the Figure legends.

Ethics

According to the German Animal Welfare Act (§4, section 4), sacrificing animals solely to remove organs for scientific purposes is notified to the competent authority. All animal experiments were approved by the Lower Saxony Committee on the Ethics of Animal Experiments as well as the responsible state office (Lower Saxony State Office of Consumer Protection and Food Safety) under the permit number 33.19-42502-04-20/3540. This study was carried out in accordance with the principles of the Basel Declaration as well as recommendations as defined by FELASA (Federation of European Laboratory Animal Science Associations) and the German animal welfare body GV-SOLAS (Gesellschaft für Versuchstierkunde/Society for Laboratory Animal Science).

Acsbg1 deficiency impairs T_H17 and T_reg cell differentiation in vitro

Acsbg1 has been identified as part of a unique epigenetic signature that distinguishes ex vivo T_H17 cells from other T_H cell subsets, with selective demethylation correlating with increased gene expression [26]. Recently, Kanno et al. identified Acsbg1 as a metabolic checkpoint for T_reg cells that regulates mitochondrial fitness and is expressed in both ex vivo T_reg and iT_reg cells [28]. These findings suggest that Acsbg1 may play an important role in T_H17 and T_reg biology.

To assess the role of Acsbg1 in modulating the differentiation of T_H cell subsets, we examined the effects of Acsbg1 deficiency on in vitro CD4⁺ T cell differentiation. Lymphocytes were isolated from the spleens of Acsbg1^+/+ and Acsbg1^−/− mice. Sorted CD4⁺CD25⁻CD62L^high T_naïve cells (Supplementary Fig. 1A) were cultured for four days under T_H0 (non-polarizing), T_H1, T_H17, or iT_reg polarizing conditions, followed by flow cytometric analysis (Supplementary Fig. 1B, Fig. 1A–E). Under T_H1-polarizing conditions, both Acsbg1^+/+ and Acsbg1^−/− cells showed a high frequency of Foxp3⁻T-bet⁺ and IFN-γ⁺ cells, consistent with the expected differentiation profile. However, no significant differences were observed between Acsbg1^+/+ and Acsbg1^−/− cultures (Fig. 1A–B). Instead, under T_H17 polarizing conditions, both genotypes generated high frequencies of Foxp3⁻RORγt⁺ and IL-17A⁺ cells (Fig. 1C–D). However, the frequency of Foxp3⁻RORγt⁺ cells was significantly reduced in Acsbg1^−/− cultures compared to Acsbg1^+/+ controls, whereas the frequency of IL-17A⁺ cells remained comparable between the two groups (Fig. 1C–D). Similarly, under iT_reg polarizing conditions, both Acsbg1^+/+ and Acsbg1^−/− cultures produced a high frequency of Foxp3⁺ cells, but the frequency of Foxp3⁺ cells was significantly lower in Acsbg1^−/− cultures compared to Acsbg1^+/+ controls (Fig. 1E). Under these conditions, IL-10 expression was barely detectable in both groups, making it difficult to evaluate potential differences in IL-10 production (Fig. 1E).

View Full Size

Acsbg1 deficiency affects in vitro T_H17 and T_reg cell differentiation. T_naïve cells from Acsbg1^+/+ and Acsbg1^−/− mice were cultured under the indicated polarizing conditions for four days, followed by flow cytometric analysis. Representative flow cytometry plots on the left show the expression of key markers for Acsbg1^+/+ and Acsbg1^−/− cells, while bar graphs on the right show the frequency of specific cell populations across all conditions for Acsbg1^+/+ (blue) and Acsbg1^−/− (red) cells: (A) Foxp3⁻T-bet⁺ (T_H1), (B) IFN-γ⁺ (T_H1), (C) Foxp3⁻RORγt⁺ (T_H17), (D) IL-17A⁺ (T_H17), and (E) Foxp3⁺ (iT_reg). Data were pooled from two independent experiments with 4 biological replicates. Each symbol represents the mean of technical triplicates performed for each condition in each experiment. Data are presented as mean ± SEM. Statistical significance was assessed using an ordinary two-way ANOVA with Šidák multiple comparison test (***P < 0.001)

Citation: European Journal of Microbiology and Immunology 15, 1; 10.1556/1886.2025.00003

• Download Figure
• Download figure as PowerPoint slide

Taken together, these results demonstrate that Acsbg1 deficiency selectively impairs in vitro T_H17 and T_reg differentiation, while leaving T_H1 differentiation unaffected. These findings highlight the potential role of Acsbg1 in the regulation of specific CD4⁺ T cell subsets.

Acsbg1 is preferentially expressed in in vitro differentiated T_H17 cells

To determine whether Acsbg1 expression is specifically induced during T_H17 and iT_reg differentiation, we examined its mRNA levels in in vitro differentiated CD4⁺ T cell subsets. T_naïve cells, sorted from the spleen of Acsbg1^+/+ mice as described above (Supplementary Fig. 1A), were cultured for four days under T_H0 (non-polarizing), T_H1, T_H17, or iT_reg polarizing conditions (Fig. 2). At the end of the cultures, cells were harvested, total RNA was extracted and converted to cDNA, and Acsbg1 expression was assessed by RT-qPCR. Minimal or no Acsbg1 expression was detected in T_H0 and T_H1 cells, whereas T_H17 and iT_reg cells showed significantly higher levels of Acsbg1 expression. Notably, Acsbg1 expression was significantly higher in T_H17 cells compared to iT_reg cells (Fig. 2A).

View Full Size

Acsbg1 is preferentially expressed by T_H17 cells in vitro. T_naïve cells from Acsbg1^+/+ and Acsbg1^−/− mice were cultured under the indicated polarizing conditions for four days, followed by RT-PCR analysis of the relative expression of (A) Acsbg1, (B) Acsl6 and (C) Acls5 in Acsbg1^+/+ (blue) and Acsbg1^−/− (red) cells cultured under the indicated conditions. Each symbol represents the mean of technical duplicates normalized to Rsp9 expression. Data are presented as mean ± SEM. Results are representative of pooled data from two independent experiments with (A) 8–10 or (B–C) 4–5 biological replicates. Statistical significance was determined by two-way ANOVA with Tukey's multiple comparison test (***P < 0.001, ****P < 0.0001)

Citation: European Journal of Microbiology and Immunology 15, 1; 10.1556/1886.2025.00003

• Download Figure
• Download figure as PowerPoint slide

To investigate whether the absence of Acsbg1 triggers compensatory mechanisms, we examined the expression of two paralogs, Acsl6 and Acsl5. RT-qPCR analysis revealed no significant changes in the expression of either Acsl6 or Acsl5 in Acsbg1^−/− cultures compared to Acsbg1^+/+ controls under any of the in vitro differentiation conditions tested (Fig. 2B and C).

These results indicate that, although Acsbg1 is not demethylated in in vitro differentiated T_H17 and iT_reg cells [26], it is expressed in both subsets, with the highest expression levels detected in T_H17 cells. Furthermore, deletion of Acsbg1 does not induce compensatory expression of related paralogs, such as Acsl6 or Acsl5, highlighting the specific and non-redundant role of Acsbg1 in T cell differentiation.

Acsbg1 deficiency leads to more severe transfer colitis

While in vitro assays have provided insight into the role of Acsbg1 in the differentiation and function of T_H17 and T_reg cells, they do not fully recapitulate the in vivo behavior of the T cells. To overcome this limitation and to better study the role of Acsbg1 deficiency in vivo, we used an adoptive transfer colitis model based on the transfer of T_naïve cells into immunodeficient recipients. Lymphocytes were isolated from the spleen of Acsbg1^+/+ or Acsbg1^−/− mice, and Lin⁻CD4⁺CD25⁻CD62L^high T_naïve cells were sorted as shown in Supplementary Fig. 1A. A total of 3 x 10⁵ T_naïve cells were transferred into sex-matched Rag2^−/− mice by intraperitoneal injection. Rag2^−/− mice injected with PBS served as controls. To monitor the development of colitis, the body weight was measured for 8 weeks after adoptive transfer (Fig. 3A). As expected, PBS-injected mice did not develop colitis, as indicated by a steady increase in body weight (Fig. 3A). Instead, mice injected with Acsbg1^+/+ T_naïve cells developed pronounced signs of colitis, as indicated by a loss of body weight starting approximately 3 weeks after adoptive transfer and persisting until 5 weeks post-injection (Fig. 3A). After 5 weeks, these mice began to regain body weight, suggesting partial resolution of colitis symptoms (Fig. 3A). Interestingly, mice injected with Acsbg1^−/− T_naïve cells also showed body weight loss from around 3 weeks post-transfer; however, unlike the Acsbg1^+/+ group, these mice did not show any signs of weight recovery. Instead, they continued to lose body weight progressively until the end of the experiment, indicating more severe and prolonged colitis, as well as increased pathogenicity of Acsbg1-deficient CD4⁺ T cells (Fig. 3A). Consistent with these data, survival analysis revealed a trend towards reduced survival in mice receiving Acsbg1^−/− T_naïve cells compared to Acsbg1^+/+ cells (Fig. 3B).

View Full Size

Transfer of Acsbg1 deficient T_naïve cells results in greater body weight loss. CD62L^highCD25⁻CD4⁺Lin⁻ T_naïve cells were sorted from pooled spleens of Acsbg1^+/+ (blue) or Acsbg1^−/− (red) mice. 3 × 10⁵ T_naïve cells were adoptively transferred into sex-matched Rag2^−/− mice by intraperitoneal injection. Control groups received PBS (white, dotted line). Mice were monitored over 56 days post infection. (A) Percentage change in body weight and (B) Kaplan-Meier survival curves were evaluated over the time course of the experiment. Eight weeks after adoptive transfer of Acsbg1^+/+ or Acsbg1^−/− T_naïve cells, mice were sacrificed, and the length and weight of the (C) colon and (D) small intestine were assessed and depicted as weight to length ratio in the plot with bars. (E) Representative haematoxylin and eosin (H&E) staining of colon samples are shown. Scale bars represent 50 µm. Transmural invasion of inflammatory cells (i), epithelial hyperplasia (h), and loss of goblet cells (g) are labeled. (F) Bar plot showing the total histological score as a sum of five histological parameters: area involved, crypt hyperplasia, leukocyte invasion, severity of inflammation, and single cell apoptosis. Each symbol represents a single mouse. Data are presented as mean ± SEM. Data represent pooled results from 5 independent experiments with 7–15 mice or (B) 14–53 mice per experimental group. (A, C and D, F) Significance of differences between means was assessed using an ordinary two-way ANOVA with Tukey's multiple comparison test (**P < 0.01, ***P < 0.001, ****P < 0.0001). In (A) the significance of the difference between Acsbg1^+/+ and Acsbg1^−/− T_naïve group means is shown at individual time points after injection. (B) Survival analysis was performed using the Log-Rank Test (Mantel-Cox) between the three survival curves (Chi-square = 8.878, df = 2, P = 0.0118) and between the Acsbg1^+/+ or Acsbg1^−/− groups (Chi-square = 1,502, df = 1, P = 0.2159)

Citation: European Journal of Microbiology and Immunology 15, 1; 10.1556/1886.2025.00003

• Download Figure
• Download figure as PowerPoint slide

At 8 weeks after adoptive transfer, both Acsbg1^−/− and Acsbg1^+/+ T_naïve cell-transferred mice exhibited similar colon and small intestine weight-to-length ratios, which were significantly higher than PBS controls (Fig. 3C and D). Consistent with these findings, histological analysis of colon samples confirmed comparable inflammatory changes in both groups, including severity of inflammation, leukocyte invasion, single cell apoptosis, area involved, and crypt hyperplasia (Fig. 3E and F). These findings suggest that while Acsbg1 deficiency exacerbated weight loss and survival outcomes, the overall level of colonic inflammation remained largely unaffected.

To further investigate the impact of Acsbg1 deficiency on T cells in vivo, mice were sacrificed 8 weeks after adoptive transfer and flow cytometric analyses were performed on T cells isolated from the colonic lamina propria (Supplementary Fig. 2A and B). Despite similar frequencies of pro-inflammatory cytokine-producing cells, immunophenotyping revealed an increased absolute number of IFN-γ⁺IL-17A⁻, IFN-γ⁻IL-17A⁺, IFN-γ⁺IL-17A⁺, and IL-22⁺ CD4⁺ T cells among colonic lamina propria CD4⁺ T cells in Acsbg1^−/− T_naïve-transferred mice compared to Acsbg1^+/+ controls (Supplementary Fig. 3A–D), supporting the hypothesis that Acsbg1 deficiency may result in an increased pathogenicity of CD4⁺ T cells. Despite an increased IFN-γ production, the frequency and absolute number of T_H1 cells (Foxp3⁻T-bet⁺) remained unchanged (Fig. 4A). However, the absolute number of T_H17 cells (Foxp3⁻RORγt⁺) was significantly increased in Acsbg1^−/− T_naïve-transferred mice compared to Acsbg1^+/+ controls, whereas the frequency of T_H17 cells remained comparable between the groups (Fig. 4B). Interestingly, an imbalance between Foxp3^- conventional T (T_conv) and T_reg cells was observed in Acsbg1^−/− T_naïve cell-transferred mice compared to Acsbg1^+/+ controls. The frequencies of T_conv cells were significantly reduced (Supplementary Fig. 3E), whereas the frequencies and absolute numbers of CD25⁺Foxp3⁺ T_reg cells were significantly increased in Acsbg1^−/− T_naïve cell-transferred mice compared to Acsbg1^+/+ controls (Fig. 4C).

View Full Size

Transfer of Acsbg1 deficient T_naïve cells results in more severe colitis. CD62L^highCD25⁻CD4⁺Lin⁻ T_naïve cells were sorted from pooled spleens of Acsbg1^+/+ (blue) or Acsbg1^−/− (red) mice. 3 × 10⁵ T_naïve cells were adoptively transferred into sex-matched Rag2^−/− mice by intraperitoneal injection. Control groups received PBS (white). Eight weeks after adoptive transfer, mice were sacrificed and flow cytometric analysis was performed on cells isolated from the colonic lamina propria. Summary graphs of the frequencies and absolute cell numbers of (A) Foxp3⁻T-bet⁺, (B) Foxp3⁻RORγt⁺, (C) Foxp3⁺CD25⁺ cells among CD8⁻CD4⁺ T cells. Each symbol represents a single mouse. Data are presented as mean ± SEM. Data represent results pooled from 5 independent experiments with 11–15 mice. Significance of differences between means was assessed by Mann-Whitney test (*P < 0.05, ***P < 0.001)

Citation: European Journal of Microbiology and Immunology 15, 1; 10.1556/1886.2025.00003

• Download Figure
• Download figure as PowerPoint slide

In conclusion, these results suggest that Acsbg1 deficiency exacerbates colitis by dysregulating T_H17 and T_reg cell differentiation and function, leading to increased pathogenicity of CD4⁺ T cells. This highlights the essential role of Acsbg1 in maintaining immune homeostasis and provides a basis for further exploration of its therapeutic potential in intestinal inflammatory diseases.