View More View Less
  • 1 University of the Punjab, Quaid-e-Azam Campus, Lahore, Pakistan
Open access

Pakistan holds the position of top chilies producers. So Capsicum annuum L. production in Pakistan should be promoted by combating against diseases. The only solution is to cultivate resistant varieties. Presently six chili varieties were treated with Fusarium oxysporum Schlecht. and screened for the most resistant and the most susceptible varieties. Representative varieties were evaluated for their biochemical and transcriptional profiles to discover the bases of antifungal-resistance. Results concluded that the most resistant variety was “Dandicut” and the most susceptible was “Ghotki”. Tannins, coumarins, flavonoids, phenolics, Riboflavins and saponins were observed in higher quantities in Dandicut as compared to Ghotki. Defense related enzymes i.e. polyphenol oxidase, phenyl ammonia lyase and peroxidase were found in elevated amounts in Dandicut than in Ghotki. Transcriptional results showed that defense related genes i.e. PR2a, acidic glucanase; Chitinase 3, acidic; Osmotin-like PR5 and Metallothionein 2b-like had higher expressional rates in Dandicut. Pearson’s correlation coefficient revealed stronger direct interaction in signal transduction and salicylic acid pathway. Resistance of chili varieties is salicylic acid based. Results obtained from this study not only help to improve chili production in Pakistan but also facilitate variety development operations. Moreover, it also constructed a scale to evaluate innate resistance among varieties.

Abstract

Pakistan holds the position of top chilies producers. So Capsicum annuum L. production in Pakistan should be promoted by combating against diseases. The only solution is to cultivate resistant varieties. Presently six chili varieties were treated with Fusarium oxysporum Schlecht. and screened for the most resistant and the most susceptible varieties. Representative varieties were evaluated for their biochemical and transcriptional profiles to discover the bases of antifungal-resistance. Results concluded that the most resistant variety was “Dandicut” and the most susceptible was “Ghotki”. Tannins, coumarins, flavonoids, phenolics, Riboflavins and saponins were observed in higher quantities in Dandicut as compared to Ghotki. Defense related enzymes i.e. polyphenol oxidase, phenyl ammonia lyase and peroxidase were found in elevated amounts in Dandicut than in Ghotki. Transcriptional results showed that defense related genes i.e. PR2a, acidic glucanase; Chitinase 3, acidic; Osmotin-like PR5 and Metallothionein 2b-like had higher expressional rates in Dandicut. Pearson’s correlation coefficient revealed stronger direct interaction in signal transduction and salicylic acid pathway. Resistance of chili varieties is salicylic acid based. Results obtained from this study not only help to improve chili production in Pakistan but also facilitate variety development operations. Moreover, it also constructed a scale to evaluate innate resistance among varieties.

Introduction

The chili is actually a fruit pod from the plant belonging to the nightshade family of Solanaceae. Chili pepper has a very hot and pungent flavor. The medicinal effects of chilies were known to pre-Hispanic people, and the modern science has confirmed the medicinal as well as nutritional value of the crop. Large amounts of vitamin A, vitamin C, vitamin E, and vitamin B1-3 have been detected in chilies [1]. Indian subcontinent is the largest producer of chilies in the whole world with its annual production of millions tons [2]. The important exporter countries of chilies are India, South Africa, China, Pakistan, Mexico, Malawi, and Zimbabwe [3].

There are numerous reasons affecting directly or indirectly the chili yield in Pakistan. Mal-cultural practice is one of those major reasons of yield loss [4]. Phytophthora root rot is another fungal infection of chilies which is very common in Pakistan. It also affects the chili price in international market or even chili approach to market. Wilt of chili is caused by the Fusarium oxysporum also known as Fusarium wilt. In Pakistan, Fusarium wilt of chili has caused 15% to 20% yield losses in dry areas during the last few years [5]. In current agricultural practices, fungus is controlled with synthetic chemical fungicides which effectively do so but are also disturbing our environment [6]. Plants are rich in several phytochemicals which are known to play important role in plant metabolism and defense against several diseases [79]. Phytochemicals also have countless benefits to humans as they are exploited as natural pesticides, flavorings, fragrances, medicinal compounds, fibers, beverages, and food products. These compounds protect host against bacteria, fungi, herbivores, insects, and viruses that plague the plant [10].

Plant defensive compounds are actually the secondary metabolites of plant's vegetative part and produce [11, 12]. They are among the most potent and therapeutically beneficial bioactive compounds, but their main function is to defend plants against invading pathogens including bacteria, fungi, and viruses [13]. They are also essential to plant life by making food unpalatable to herbivorous predators [14]. Most of the defense biochemicals are antioxidants due to their redox properties, which allow them to act as reducing agents, hydrogen donators, and singlet oxygen quenchers.

Due to enormous antimicrobial activities of defense biochemicals, during recent years, researches have been diverted towards the disease control by using plant metabolites as they are not serious hazard for environment and also not harmful for human health. In the present study, natural plant defenses have been evaluated against a fungal disease and may be potentially used against fungal pathogen F. oxysporum in case of chilies.

Materials and Methods

Procurement of Chili Varieties and Fungal Culture

Six chili varieties (i.e., Mexi, Nageena, Talhari, Ghotki, Sanam, and Dandicut) were procured from agriculture seed market, Lahore, Pakistan. The pathogenic isolate of F. oxysporum was obtained from Fungal Biotechnology Lab, University of the Punjab, Lahore, Pakistan. The culture was stored at 4 °C and subcultured monthly.

Screening of Representative Varieties

A screening test was performed to evaluate the most resistant and the most susceptible variety of chilies against F. oxysporum. The pathogenicity test was performed by using the protocol of Shafique et al. [15]. Disease rating scale was made on the basis of disease incidence and disease severity. Disease incidence was observed as the symptoms appeared on the plant, and disease index was calculated with the help of following formula:

Disease Severity=Area of Plant Part AffectedTotal Area×100
Disease Index=Number of Plants in Particular CategoryTotal Number of Plants×100

Quantification of Biochemicals

The representative varieties obtained through primary screening were further subjected to biochemical analysis to verify their quantitative potential.

Quantification of Tannins

Five hundred milligrams of plant material was extracted for 30 min with 50 mL of methanol (80%). Extracts were filtered twice to remove plant debris, and then, 50 mL of the end volume was achieved by adding the same solvent as previous one. To quantify the tannin contents, 500 μL of extract was transferred in a test tube. Then, the prepared chemical solutions, i.e., folin–ciocalteu reagent (500 μL), sodium carbonate (1 mL), and distilled water (8 mL), were added. Reaction mixture was incubated at room temperature for 30 min. The first light absorbance was recorded at 760 nm through spectrophotometer (model: UT 2100 UV, Utech Products Inc., USA). Then, 0.5 g of casein was added into glass flask prior to addition of equal volumes of extract and distilled water (5 mL of each). After 2 h of incubation at room temperature, the mixture was filtered and the weight of residue was recorded.

Quantification of Coumarins

Preweighed plant material (0.5 g) was extracted with 50 mL of methanol (80%), and all the plant debris were removed by filtration. After that, the extract concentration was adjusted to 1 mg/ml by adding 80% methanol in it.

For quantification of coumarins, 0.5 mL of extract was taken into a test tube. Then, equal volume of lead acetate solution was added to it prior to dilution with 9 mL of distilled water. After rigorous shaking, 2 mL of this mixture was transferred to a new tube. In that tube, 8 mL of HCl solution was also added and incubation period of half an hour was provided at room temperature. Then absorbance was recorded at 320 nm and compared with the calibration curve to determine total coumarin contents.

Quantification of Flavonoids

Plant material (0.5 g) was extracted with 80% methanol. Extraction process continued up to half an hour at hot plate. Then, plant debris was removed by filtering the mixture and final volume of extract was increased by adding the same solvent again to get the final concentration of 1 mg/ml.

Quantity of flavonoids was determined by taking 0.5 mL of plant extract into a test tube containing equal volume of acetic acid solution. Then, other reagents were added to that test tube in order of pyridine solution (2 mL), aluminum chloride solution (1 mL), and 80% methanol solution (6 mL). The mixture was incubated for 30 min at room temperature, and then, light absorbance was recorded at 420 nm and compared with calibration curve, drawn by rutin to quantify flavonoids in given samples.

Quantification of Total Phenolics

Plant sample (1 g) was extracted with 80% methanol at hot plate at 70 °C for 15 min. Then, plant debris was removed through filtration, and 1 mL of extract was added up with 5 mL of distilled water accompanied with 0.25 mL of folin–ciocalteu reagent. Reaction mixture was incubated at 25 °C, and absorbance was taken at 725 nm in a spectrophotometer and compared with calibration curve.

Determination of Riboflavin

Weighed 5 g of plant material was taken, and extraction was done with ethanol (50%) for 1 h with continuous shaking. After removal of plant debris, 10 mL of plant extract was added up with 10 mL of 5% potassium permanganate and 10 mL of 30% hydrogen peroxide. Mixture was heated for 30 min, and then, 2 mL of sodium sulfate (40%) was added into mixture. Afterwards, water was added to the mixture to make the final volume 50 mL and absorbance was taken at 510 nm.

Determination of Alkaloids

Five grams of plant material was taken and soaked in 20% acetic acid solution prepared in ethanol for 4 h and then filtered and evaporated in rotary evaporator to one fourth of original volume. Then, concentrated ammonium solution was added to precipitate alkaloids. Precipitant was collected through filtration and weighed [16].

Determination of β-glucans

The method of Gruppen et al. [17] was used to quantify β-glucans of plant sample. Five grams of plant sample was extracted with dis. water and filtered. Absolute ethanol was added into extracts to precipitate polysaccharides which were filtered. Then, arabinoxylans were removed by the addition of Ba(OH)2 into filtrate and water was added in filtrate in equal volume. Aqueous layer was taken and evaporated to obtain β-glucans.

Determination of Saponins

Plant material was taken and shaken well in 100 mL of 20% ethanol. Mixture was heated up to 55 °C for 4 h and then filtered and bi-extracted with same solvent. Both extracts were combined and evaporated to reduce the volume up to 40 mL. Then, half volume of diethyl ether was added into it, and after vigorous shaking the aqueous layer was recovered. Same procedure was repeated by using n-butanol, and this time, n-butanol layer was isolated. These extracts were given washing with 10 mL of 5% NaCl, and extracts were dried in rotary evaporator to get solid saponins [16].

Determination of Pectin

Water extracts of 5 g plant material were prepared at boiling temperature for 1 h and then filtered, and extracts were added with 1 mL of NaOH and 30 mL of water and kept overnight. Afterwards, extracts were neutralized with 5 mL of acetic acid solution. After 5 min of intact stay, extracts were added up with 2.5 mL of calcium chloride solution. Residues were allowed to dry in a preweighed beaker to get solid pectins.

Enzymatic Assays

T o determine enzymatic activities, the crude enzyme extracts were obtained through crushing the 1 g plant material in 3 mL of sodium phosphate buffer (pH 6.8) and precipitated with acetone. Protein pallet was dissolved in 8 M urea solution and used as enzyme source in downstream enzymatic analyses. The method described by Mayer et al. [18] was used to determine polyphenol oxidase (PPO) activity in plant samples by taking the spectrophotometric absorbance at 495 nm. Likewise, the method of Burrell and Rees [19] was adopted to determine the activity of phenyl ammonia lyase (PAL) at 290 nm absorbance. Peroxidase activity was determined by using the method as described by Fu and Huang [20], and light absorbance was taken at 470 nm after 1 min interval.

Hydrocarbons Assays

One gram of plant material was crushed and extracted with n-heptane (10 mL). This extract was washed by equal volume of distilled deionized water, and upper organic layer was collected to record its absorbance for quantification of hydrocarbons [21]. Triterpenoids were quantified through the following equation:

ε190nm=90±5mM1cm1
while carotenoids quantification was carried out by using following equation:
ε450nm=165±5mM1cm1

Pathogenesis-related Gene Expression Analysis

Reverse transcriptase (RT) polymerase chain reaction (RT-PCR) was performed to analyze the expression of resistance specific genes of chilies varieties. RNA isolation from 1 g leaf tissues of both chili varieties was carried out separately by using kit of “biomol,” RiboEX (TM). The same kit was utilized to synthesize cDNA of both chili varieties.

Semi-quantitative RT-PCR

In this study, α-Tubulin was used as housekeeping gene due to its strong recommendation by Coker and Davies [22]. A primer set used for studying α-Tubulin expression was the same as used by Xu and Shi [23], at their recommended thermocyclic conditions in GeneAmp-2700 thermocycler (Applied Biosystems, 850 Lincoln Centre Drive, Foster City, CA, USA). Primer sequences targeting housekeeping gene were [F]: TGAACAACTCATAAGTGGCAAAG and [R]: TCCAGCAGAAGTGACCCAAGAC. The PCR products were electrophorated on 1% agarose gel and compared to analyze the equal expression of housekeeping gene.

cDNA synthesized and constructed in previous reaction was used as template in separate reactions. The quantity of amplified product at the end of the reaction was assumed to be directly related with the initial transcriptome contents isolated from plants. It was considered as the extent of gene expression. Amplifications were recorded with six primer sets (Table 1). Temperature conditions were provided to each primer as recommended by Kavroulakis et al. [24]. PCR product was electrophorated on agarose gel (1%) to visualize the amplified bands.

Table 1.

Pathogenesis related genes controlling innate antifungal resistance in plants

Gene familySpecific classAccession numbersPrimer detailsTm (°C)References
PR1PR1b, basic PR1AJ011520F-CCAAGACTATCTTGCGGTTC57.3Van Kan et al. [25]
R-GAACCTAAGCCACGATACCA57.3
PR2PR2a, acidic glucanaseM80604F-TATAGCCGTTGGAAACGAAG55.3
R-TGATACTTTGGCCTCTGGTC57.3
PR2b, basic glucanaseM80608F-CAACTTGCCATCACATTCTG55.3
R-CCAAAATGCTTCTCAAGCTC55.3
PR3Chitinase 3, acidicZ15141F-CAACTTGCCATCACATTCTG55.3Danhash et al. [26]
R-CCAAAATGCTTCTCAAGCTC55.3
Chitinase 9, basicZ15140F-AATTGTCAGAGCCAGTGTCC57.3
R-TCCAAAAGACCTCTGATTGC55.3
PR5Osmotin-like PR5AY093593F-AATTGCAATTTTAATGGTGC49.1Rep et al. [27]
F-TAGCAGACCGTTTAAGATGC55.3
PR7P69A, subtulisin-likeY17275F-AACTGCAGAACAAGTGAAGG55.3Tornero et al. [28]
R-AAC GTGATTGTAGCAACAGG55.3
MT2bLMetallothionein 2b-likeEF584509F-AGTACGCGGGGAGCAAC57.3
R-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAT57.2

Data Analysis

Standard errors of means of all the replicates of each treatment were computed using computer software Microsoft excel. All the data were analyzed by analysis of variance (ANOVA) followed by Duncan's new multiple range (DMR) test to separate the mean differences. Photographs of gel were analyzed through GELANALYZER (Lazar, Hungary) to determine the intensity of the band, molecular weight, and Rf value of each amplified gene. The intensity of gene expression was taken into account to determine interrelations of different plant pathways using DSAASTAT (Onofri, Italy). Moreover, it was also used to compare pathway values with each other according to Pearson's correlation coefficient (PCC).

Results

Pathogenicity Assay

Six chili varieties were taken and inoculated with F. oxysporum to evaluate the most resistant and the most susceptible variety of chilies. Infection and visible characteristic symptoms were evident after 10 days of inoculation. Initially, the plants displayed yellowing on the leaves that was turned into chlorosis and necrosis; slowly, it was converted to wilting and, eventually, the death of the whole plant. Results obtained were portrayed in Figure 1 which depicted that the maximum disease was induced in variety Ghotki, so it was stated as the most susceptible variety. The following susceptible varieties were Mexi and Talhari, which were more or less equally attacked by the pathogen and exhibited nonsignificant difference in disease indexes after the attack of pathogen. Nageena ranked third in the susceptibility index of chili varieties as it displayed about 50% disease index. The most resistant variety of chilies against Fusarium wilt was Dandicut as it displayed only 16% disease index. Sanam was closely followed by the Dandicut among the resistant varieties and revealed 33% disease index (Figure 1).

Thus, Ghotki was the most susceptible and Dandicut was the most resistant variety among the representative varieties, respectively.

Figure 1.
Figure 1.

Disease index of selected chili varieties against F. oxysporum. Significance level of data was analyzed through Duncan's multiple range test at P ≤ 0.05 and presented as values with different letters. Vertical bars indicate standard error of means of three replicates

Citation: European Journal of Microbiology and Immunology EuJMI 8, 1; 10.1556/1886.2017.00031

Biochemical Quantifications

The representative varieties were subjected to quantitative biochemical analysis to scrutinize their resistance potential, and the results obtained are summarized in Figure 2. Susceptible variety (Ghotki) exhibited 0.0358 g/kg tannin contents in comparison with 0.432 g/kg tannin contents of resistant variety (Dandicut) which were found to be 12 times more in resistant variety than susceptible variety.

In case of coumarins, the resistant variety exhibited about 11 times more coumarins content in comparison to susceptible variety. It was evident from Figure 2 that resistant variety contained increased amounts of coumarins (30.67 g/kg) in their leaf tissues with respect to susceptible variety (2.918 g/kg).

Enhanced quantities of phenolics were presented in leaves of resistant chili variety than susceptible variety. Numerical value of phenolics in Dandicut was 3.1 g/kg, which was 4.5 times more than 0.675 g/kg phenolics of Ghotki.

Results revealed that about twice the amounts of riboflavin contents were detected in resistant variety with numeric values of 1.435 and 0.658 g/kg in leaf tissues of Dandicut and Ghotki, respectively.

Lesser quantities of alkaloids were recorded in chili variety exhibiting more antifungal resistance than the susceptible variety, as Ghotki exhibited 0.083 g/kg of alkaloids in their leaf tissues in comparison with 0.068 g/kg alkaloids of Dandicut.

The results demonstrated that the quantity of β-glucans was more in susceptible chili variety with lesser antifungal resistance as Ghotki revealed 0.184 g/kg of β-glucans, while 0.138 g/kg β-glucan contents were found in leaves of Dandicut.

The quantitative analysis of saponin contents of the representative varieties revealed that the resistant variety possessed about 5% more saponin contents than the susceptible chili variety as Figure 2 showed that the saponin content of Ghotki was 4.3 g/kg and Dandicut was 4.5 g/kg, respectively.

From the data analysis, it was found that 0.076 g/kg pectins were present in leaves of Ghotki in comparison to 0.059 g/kg pectin contents of Dandicut. Thus, more quantities of pectins were recorded in chili variety (Ghotki) with reduced antifungal resistance in comparison to Dandicut.

Figure 2.
Figure 2.

Comparison of different biochemical compounds of resistant and susceptible varieties. Significance level of data was analyzed through Duncan's multiple range test at P ≤ 0.05 and presented as values with different letters. Vertical bars indicate standard error of means of three replicates

Citation: European Journal of Microbiology and Immunology EuJMI 8, 1; 10.1556/1886.2017.00031

Analysis of Enzymatic Assays

The analysis of defense related enzymes of representative varieties revealed that the resistant variety possessed enhanced enzymatic activity as compared to susceptible one (Figure 3). It was clarified from the results that polyphenol oxidase activity had a direct interconnection with antifungal resistance as Ghotki showed 0.108 PPO activity in comparison with 0.16 activity of PPO in Dandicut leaves. About 20% increased PAL activity was detected in resistant variety. Similarly, Ghotki variety with reduced resistance was found to express 39.77 per oxidase (PO) activity; in contrast to it, Dandicut, with more antifungal resistance, exhibited 43.028 activity of PO (Figure 3).

Figure 3.
Figure 3.

Comparison of defense related enzyme activity of resistant and susceptible varieties. Significance level of data was analyzed through Duncan's multiple range test at P ≤ 0.05 and presented as values with different letters. Vertical bars indicate standard error of means of three replicates

Citation: European Journal of Microbiology and Immunology EuJMI 8, 1; 10.1556/1886.2017.00031

Analysis of Hydrocarbons Assays

The representative varieties were further subjected to analysis of hydrocarbons to verify their quantitative potential. The results evidenced that the quantities of triterpenoids were found to be negatively associated with antifungal resistance of chili varieties, as Ghotki exhibited 25.2 g/kg triterpenoids, whereas Dandicut possessed 19.8 g/kg triterpenoid contents with more antifungal potential. Conversely, carotenoid contents were found to be directly correlated with chili antifungal resistance, as Chili variety with lesser resistance had 14.85 g/kg carotenoids in comparison with 28.05 g/kg carotenoids of chili variety (Dandicut) with enhanced antifungal resistance (Figure 4).

Figure 4.
Figure 4.

Comparison of triterpenoids and carotenoids of resistant and susceptible varieties. Significance level of data was analyzed through Duncan's multiple range test at P ≤ 0.05 and presented as values with different letters. Vertical bars indicate standard error of means of three replicates

Citation: European Journal of Microbiology and Immunology EuJMI 8, 1; 10.1556/1886.2017.00031

Molecular Analysis

Molecular analysis revealed that the genes PR2a, acidic glucanase; chitinase 3, acidic; osmotin-like PR5; and metallothionein 2b-like had significantly greater expression in resistant variety while PR1b, basic PR1 and chitinase 9, basic genes did not express any transcriptional difference among varieties. Variability in plant innate resistance did not affect the expression of these genes. Bands of two genes (PR2a, acidic glucanase and chitinase 3, acidic) of resistant variety were more than two times stronger than respective bands of susceptible variety (Figure 5) revealing strong association of gene expression with basal antifungal resistance of chilies. Osmotin-like PR5 and metallothionein 2b-like had slightly elevated expression in resistant variety, but elevation in their expression was not as remarkable as PR2a, acidic glucanase and chitinase 3, acidic.

Transcriptional increase of 33.25% and 28.52% was recorded in case of PR2a, acidic glucanase and chitinase 3, acidic, respectively. Transcript abundance of Osmotin-like PR5 was 39.31 ng/μl in susceptible variety which was raised up to 44.17 ng/μl in resistant variety. Similarly, band intensity of metallothionein 2b-like was 40.52 and 44.36 ng/μl in susceptible and resistant variety, respectively. Transcript quantity of chitinase 9, basic was also elevated up to 25.69% in resistant variety (Figure 6).

The strongest direct interaction in resistant variety was found between signal transduction (ST) pathway and salicylic acid (SA) pathway (0.68). Jasmonic acid (JA) pathway had a direct but the poorest association with ST (0.25). SA and JA had a moderate direct interaction in resistant variety with PCC value of 0.34. Susceptible variety exhibited a significantly higher PCC value between SA and JA, indicating that both pathways had more pronounced interrelations in susceptible as compared to resistant chili varieties. SA was not found as strongly associated with ST in susceptible variety as was found in resistant. Thus, basal antifungal resistance of chilies was mainly dependent upon SA. A stronger correlation between JA and ST was recorded in susceptible chilies than resistant (Figure 7).

Figure 5.
Figure 5.

RT-PCR gel electrophoresis image of chili varieties for expression of defense related genes. H = housekeeping gene or reference gene (α-Tubulin, used as expression control). C = collective run of 6 defense related genes (5 μL of PCR products of lane 1, 2, 3…6 were loaded in a single well). 1 = PR2a, acidic glucanase; 2 = PR1b, basic PR1; 3 = chitinase 3, acidic; 4 = chitinase 9, basic; 5 = osmotin-like PR5; 6 = metallothionein 2b-like; R = resistant variety; S = susceptible variety

Citation: European Journal of Microbiology and Immunology EuJMI 8, 1; 10.1556/1886.2017.00031

Figure 6.
Figure 6.

Band intensity graph of R and S lines under C category of “figure V.” Black line indicates genetic expression of resistant variety, whereas red line shows gene expression profile of susceptible variety. Bands of different genes have been tagged with different numbers, i.e., 1 = PR2a, acidic glucanase; 2 = PR1b, basic PR1; 3 = chitinase 3, acidic; 4 = chitinase 9, basic; 5 = osmotin-like PR5; and 6 = metallothionein 2b-like

Citation: European Journal of Microbiology and Immunology EuJMI 8, 1; 10.1556/1886.2017.00031

Figure 7.
Figure 7.

Correlation of plant pathways existing in different chili varieties. PCC values indicate the type and extent of interaction in two different pathways, while “A” and “B” have been used to tag resistant and susceptible chili variety, respectively

Citation: European Journal of Microbiology and Immunology EuJMI 8, 1; 10.1556/1886.2017.00031

Discussion

Different varieties of same crop may have large differences in their innate resistance against pathogens. This variation in resistance depends upon the differences in defense weapons of plants, which are ultimately encoded by plant genome. Plant innate resistance may vary with the variety [29]. Different crop varieties may possess different levels of characters or even different characters. The present and future focus is on continuing improvement of agronomic traits such as yield and abiotic stress resistance in addition to the biotic stress tolerance of the present generation.

Tannin is a specialized group of plant originated phenolic compounds. The antimicrobial activity of tannins is basically dependent upon their ability to prevent microbial adhesion with host surface. Many researchers have reported that tannins are toxic to yeasts, filamentous fungi, and bacteria [30]. The present study is also the reminiscent of all these previous researches in which tannins have been reported as antimicrobial agents. It can be suggested that antifungal resistance in Dandicut is dependent upon increased quantities of tannins in them.

Coumarins are phenolic substances [31]. Higher concentration of coumarins is a sign of antipathogenic activity of plants. Similar results have been obtained in this study where resistant varieties of chilies exhibited greater amounts of coumarins in their leaf tissues. The common herbs tarragon and thyme both contain caffeic acid which is effective against viruses [32], bacteria [33], and fungi [34]. Several studies had been conducted to evaluate the correlation between phenolic compounds and antioxidant activity. The antioxidant activity of Du-Zhong (Eucomnia ulmoides) [35], ear mushrooms [36], and anise (Pimpenella anisum L.) seed [37] was found to correlate with the phenolic compounds.

The role of riboflavin as a plant defense activator in chili and bean against pathogens has been rarely investigated. The present study concludes that riboflavin production plays an essential role in the defense response towards the pathogen; thus, it supports the study of Sardooei [38] and confirms the positive role of riboflavin in defense response of plants. Likewise, alkaloids have their significant share in plant defenses. From the results of our present study, it may be concluded that resistance of chilies plant has no participation of alkaloids contents because resistant plant exhibited lesser quantities of alkaloids.

In controlling fungal plant pathogens, a variety of mechanisms contributes to the biocontrol activity of microbes. Cell-wall-degrading enzymes such as β-1, 3-glucanases, cellulases, proteases, and chitinases are involved in antagonistic activity of some biological control agents against phytopathogenic fungi [39]. In parallel to this, present investigation concludes that chitinase is not always sufficient for plant antifungal resistance; thus, glucans play their role in plant defenses. Saponins have also been found in elevated amounts in the resistant variety of chilies, which confirmed their antifungal activity inside plant tissues [40]. These compounds, called phytoanticipins [41], are present constitutively in plants and seem to be involved in plant disease resistance because of their well-known antimicrobial activity [42, 43, 44]. However, many researches support the antifungal activity of pectin, but resistance of chilies is not dependent on pectin concentration because the current study has revealed that resistant varieties of chilies had lesser quantities of pectins.

In the present study, a change of defense related enzymes including PO, PPO, and PAL was detected in both chili varieties. Elevated amounts of defense related enzymes were found in resistant variety of chilies, which proved the active participation of defense related enzymes in constitutive antifungal resistance of chilies. Typically, this inducible resistance system as systemic acquired resistance (SAR) is effective against diverse pathogens including viruses, bacteria, and fungi [45]. The defense proteins make the plant resistant to pathogen invasion [46], and have been correlated with defense against pathogen invasion in cucumber [47].

Terpenenes or terpenoids are active against bacteria [10], fungi [12, 48], and viruses. Presently, it can be concluded that these compounds do not play a significant role in plant antifungal defense. It has been proved that carotenoids are effective against various food-borne pathogens, such as Staphylococcus aureus, Escherichia coli, and Salmonella enteritidis [4951]. Despite the broad antimicrobial spectrum, carotenoids were ineffective in certain plant materials [50, 51]. Thus, we suspect the involvement of carotenoids in the enhanced antimicrobial activity of carotenoids. Current research also proves that the carotenoids had antimicrobial activities that are responsible for constitutive antifungal resistance in chilies.

Plants have a variety of potential mechanisms at cellular level that might be involved in the tolerance to stress. These are involved primarily in avoiding the build-up of toxic concentrations at sensitive sites within the cell. It has been demonstrated that the physiological mechanism of resistance is not based on an enhanced synthesis of phytochemicals [52, 53] and that in resistant plants only a small proportion of stress factors seems to be coordinated by sulfur donor atoms [54, 55]. Some plants have been shown to have resistance stresses and resistance traits seem to be constitutive, as revealed by a study on a large number of European populations [56]. To evaluate the potential of resistance-mediated remediation, the genetics and physiology of resistance have to be investigated first. The current study is parallel to these researches in which resistance physiology has been studied. This would be very helpful in understanding the resistance mechanisms prevailing in plants.

Funding Sources

No special funding was provided by the university or any other agency for the research work.

Author's Contributions

Sobiya S. and Shazia S. conceived the experiment. A.A. performed it. States and write up were completed by the efforts of all the authors.

Conflict of Interest

There is no conflict of interest between the authors.

References

  • 1.

    Serra I Yamamoto M Calvo A . Association of chili pepper consumption, low socioeconomic status and longstanding gallstones with gallbladder cancer in a Chilean population. Int J Cancer. 2002;102:40711.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 2.

    Khalid S Iftikhar S Munir A Ahmad I . Potato diseases in Pakistan. PARC Islamabad. 2000:165.

  • 3.

    Anonymous . Major food and agricultural commodities and producers: countries by commodity. Online. Food and Agriculture Organization of the United Nations, Economic and Social Department, Statistics Division; 2003b.

    • Search Google Scholar
    • Export Citation
  • 4.

    Abada KA . Fungi associated with root rot of pepper and some factors affecting disease incidence. Proc 7th Conf Phytopathol Ghazza; 1994:21926.

    • Search Google Scholar
    • Export Citation
  • 5.

    Siddiqui ZA Akhtar MS . Biocontrol of a chickpea root-rot disease complex with phosphate solubilizing micro-organisms. J Plant Pathol. 2007;89:6777.

    • Search Google Scholar
    • Export Citation
  • 6.

    Groenewald S . Biology, pathogenicity and diversity of Fusarium oxysporum f. sp. cubense. Dissertation, University of Pretoria; 2005.

  • 7.

    Shafique S Shafique S . Tagetes erectus — a tool for the management of Alternaria alternata strains of tomato. In proceeding of International Conference on Applied Life Sciences, 10–13, September, Konya, Turkey; 2012. p. 30914.

    • Search Google Scholar
    • Export Citation
  • 8.

    Shafique S Abdul Majeed R Shafique S . Cymbopogon citrates: a remedy to control selected Alternaria species. J Med Plants Res. 2012;6:187985.

    • Search Google Scholar
    • Export Citation
  • 9.

    Zaheer Z Shafique S Shafique S Mehmood T . Antifungal potential of Parthenium hysterophorus L. plant extracts against Fusarium solani. Sci Res Ess. 2012;7:204954.

    • Search Google Scholar
    • Export Citation
  • 10.

    Amaral JA Ekins A Richards SR Knowles R . Effect of selected monoterpenes on methane oxidation, denitrification, and aerobic metabolism by bacteria in pure culture. App Environ Microbiol. 1998;64:5205.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 11.

    Friedman JS Tepley CA Castleberg PA Roe H . Middle-atmospheric Doppler lidar using an iodine-vapor edge filter. Opt Lett. 1997;22:164850.

  • 12.

    Ayafor JF Tchuendem MHK Nyasse B . Novel bioactive diterpenoids from Aframomum aulacocarpos. J Nat Prod. 1994;57:91723.

  • 13.

    Dahanukar SA Kulkarni RA Rege NN . Pharmacology of medicinal plants and natural products. Ind J Pharmacol. 2000;32:81118.

  • 14.

    Bennick A . Interaction of plant polyphenols with salivary proteins. Crit Rev Oral Biol Med. 2002;13:18496.

  • 15.

    Shafique S Shafique S Ahmed A . ecofriendly response of citrus peels to alternaria leaf spots of tomato: exclusive role of peel phenolics. Int J Agri Biol. 2013;15:123642.

    • Search Google Scholar
    • Export Citation
  • 16.

    Obadoni BO Ochuko PO . Phytochemical studies and comparative efficacy of the crude extracts of some homeostatic plants in Edo and Delta States of Nigeria. Global J Pure Appl Sci. 2001;8:2038.

    • Search Google Scholar
    • Export Citation
  • 17.

    Gruppen H Hamer RJ Voragen AGJ . Water-unextractable cell wall material from wheat flour. 1. Extraction of polymers with alkali. J Cereal Sci. 1992;16:4151.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18.

    Mayer AM Harel E Shaul RB . Assay of catechol oxidase: a critical comparison of methods. Phytochem. 1965;5:7839.

  • 19.

    Burrell MM Rees TA . Metabolism of phenylalanine and tyrosine in rice leaves infected by Pyricularia oryzae. Physiol Plant Pathol. 1974;4:497508.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 20.

    Fu J Huang B . Involvement of antioxidants and lipid peroxidation in the adaptation of two cool-season grasses to localized drought stress. Environ Expt Bot. 2001;45:10514.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 21.

    Eroglu E Melis A . Extra cellular terpenoid hydrocarbon extraction and quantitation from the green microalgae Botryococcus braunii Showa. Biores Technol. 2010;101:2352366.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 22.

    Coker JS Davies E . Selection of candidate housekeeping controls in tomato plants using EST data. Biotechniques. 2003;35:7408.

  • 23.

    Xu WF Shi WM . Expression profiling of the 14-3-3 gene family in response to salt stress and potassium and iron deficiencies in young tomato (Solanum lycopersicum) roots: analysis by real-time RT–PCR. Ann Bot. 2006;98:96574.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 24.

    Kavroulakis N Papadopoulou KK Ntougias S Zervakis GI Ehaliotis C . Cytological and other aspects of pathogenesis-related gene expression in tomato plants grown on a suppressive compost. Ann Bot. 2006;98:55564.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25.

    Van Kan JAL Joosten MHAJ Wagemakers CAM Van den Berg-Velthuis GCM de Wit PJGM . Differential accumulation of mRNAs encoding extracellular and intracellular PR proteins in tomato induced by virulent and avirulent races of Cladosporium fulvum. Plant Mol Biol. 1992;20:51327.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26.

    Danhash N Wagemakers CAM van Kan JAL de Wit PJGM . Molecular characterization of four chitinase cDNAs obtained from Cladosporium fulvum-infected tomato. Plant Mol Biol. 1993;22:101729.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27.

    Rep M Dekker HC Vossen JH de Boer AD Houterman PM Speijer D , Mass spectrometric identification of isoforms of PR proteins in xylem sap of fungus-infected tomato . Plant Physiol. 2002;130:904 17.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 28.

    Tornero P Conejero V Vera P . Primary structure and expression of a pathogen-induced protease (PR-P69) in tomato plants: similarity of functional domains to subtilisin-like endoproteases. Proc Natl Acad Sci USA. 1996;93:63327.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 29.

    Bingham IJ Walters DR Foulkes MJ Paveley ND . Crop traits and the tolerance of wheat and barley to foliar disease. Ann Appl Biol. 2009;154:15973.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30.

    Ya C Gaffney SH Lilley TH Haslam E . Carbohydrate–polyphenol complexation. In: Chemistry and Significance of Condensed Tannins. Hemingway RW Karchesy JJ, editors. New York: Plenum Press; 1988.

    • Search Google Scholar
    • Export Citation
  • 31.

    Fernandez MA Garcia MD Saenz MT . Antibacterial activity of the phenolic acids fraction of Scrophularia frutescens and Scrophularia sumbucifolia. J Ethnopharmacol. 1996;53:1144.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 32.

    The Complete Book of Natural and Medicinal Cures. Wild R, editor. Emmaus, PA: Rodale Press, Inc.; 1994.

  • 33.

    Brantner A Grein E . Antibacterial activity of plant extracts used externally in traditional medicine. J Ethnopharmacol. 1994;44:3540.

  • 34.

    Duke JA . Handbook of Medicinal Herbs. Boca Raton, FL: CRC Press, Inc.; 1985.

  • 35.

    Yen GC Hsieh CL . Antioxidant activity of extracts from Du-zhong (Eucommia ulmoides) toward various lipid peroxidation models in vitro. J Agric Food Chem. 1998;46:39527.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 36.

    Chao GR . Antioxidant properties and polysaccharide composition analysis of ear mushrooms. Master's Thesis. National Chung-Hsing Uni, Taiwan; 2001, p. 548.

    • Search Google Scholar
    • Export Citation
  • 37.

    Gulcin I Buyukokuroglu ME Oktay M Kufrevioglu OI . Antioxidant and analgelsic activities of turpentine of Pinus nigra Arn. Subsp. pallasiana (Lamb) Holmboe. J Ethnopharmacol. 2003;86:518.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 38.

    Sardooei ZA . Induction of resistance to Botrytis cinerea in tomato, bean and cucumber by Serratia plymuthica and plant activators. Ghent Uni Fac Biosci Engineering, Ghent Belgium; 2011.

    • Search Google Scholar
    • Export Citation
  • 39.

    Essghaier B Rouaissi M Boudabous A Jijakli H Sadfi-Zouaoui N . Production and partial characterization of chitinase from a halotolerant Planococcus rifitoensis strain M2-26. World J Microbiol Biotechnol. 2010;26:97784.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 40.

    Osbourn AE . Saponins and plant defence—a soap story. Trends Plant Sci. 1996;1:49.

  • 41.

    Osbourn AE . Antimicrobial phytoprotectants and fungal pathogens: a commentary. Fung Gen Biol. 1999;26:1638.

  • 42.

    Papadopoulou K Melton RE Leggett M Daniels MJ Osbourn AE . Compromised disease resistance in saponins-deficient plants. Proc Nat Acad Sci USA. 1999;96:129238.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 43.

    Bouarab K Melton R Peart J Baulcombe D Osbourn AE . A saponins-detoxifying enzyme mediates suppression of plant defense. Nature. 2002;418:88992.

  • 44.

    Wittstock U Gershenzon J . Costitutive plant toxins and their role in defense against herbivores and pathogens. Curr Opin Plant Biol. 2002;5:18.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 45.

    Ryals JA Neuenschwander UH Willits MG Molina A Steiner HY Hunt MD . Systemic acquired resistance. Plant Cell. 1996;8:180919.

  • 46.

    VanLoon LC . Induced resistance in plants and the role of pathogenesis-related proteins. Eur J Plant Pathol. 1997;103:75365.

  • 47.

    Rasmussen JB . Systemic induction of salicylic acid accumulation in cucumber after inoculation with Pseudomonas syringae. Plant Physiol. 1991;97:13428.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 48.

    Fujioka T Kashiwada Y . Anti-AIDS agents. Betulinic acid and platanic acid as anti-HIV principles from Syzigium claviflorum and the anti-HIV activity of structurally related triterpenoids. J Nat Prod. 1994;57:2437.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 49.

    Kamau DN Doores S Pruitt KM . Enhanced thermal destruction of Listeria monocytogenes and Staphylococcus aureus by the lactoperoxidase system. App Environ Microbiol.1990b;56:27116.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 50.

    McLay JC Kennedy MJ O'Rourke AL Elliot RM Simmonds RS . Inhibition of bacterial foodborne pathogens by the lactoperoxidase system in combination with monolaurin. Int J Food Microbiol. 2002;73:19.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 51.

    Touch V Hayakawa S Yamada S Kaneko S . Effects of a lactoperoxidase–thiocyanate–hydrogen peroxide system on Salmonella enteritidis in animal or vegetable foods. Int J Food Microbiol. 2004;93:17583.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 52.

    Ebbs S Lau I Ahner B Kochian L . Phytochelatin synthesis is not responsible for Cd tolerance in the Zn/Cd hyper accumulator Thlaspi caerulescens (J & C Presl). Planta. 2002;214:63540.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 53.

    Schat H Llugany M Vooijs R Hartley-Whitaker J Bleeker P . The role of phytochelatins in constitutive and adaptative heavy metal tolerances in hyperaccumulator and nonhyperaccumulator metallophytes. J Exper Bot. 2002;53:238192.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 54.

    Küpper H Mijovilovich A Meyer-Klaucke W Kroneck PMH . Tissue- and age-dependent differences in the complexation of cadmium and zinc in the cadmium/zinc hyperaccumulator Thlaspi caerulescens (Ganges ecotype) revealed by X-ray absorption spectroscopy. Plant Physiol. 2004;134:74857.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 55.

    Ueno D Ma JF Iwashita T Zhao FJ McGrath SP . Identification of the form of Cd in the leaves of a superior Cd-accumulating ecotype of Thlaspi caerulescens using 113Cd-NMR. Planta. 2005;221:92836.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 56.

    Bert V Bonnin I Saumitou-Laprade P de Laguerie P Petit D . Do Arabidopsis halleri from nonmetallicolous populations accumulate zinc and cadmium more effectively than those from metallicolous populations? New Phytologist. 2002;155:4757.

    • Crossref
    • Search Google Scholar
    • Export Citation

If the inline PDF is not rendering correctly, you can download the PDF file here.

  • 1.

    Serra I Yamamoto M Calvo A . Association of chili pepper consumption, low socioeconomic status and longstanding gallstones with gallbladder cancer in a Chilean population. Int J Cancer. 2002;102:40711.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 2.

    Khalid S Iftikhar S Munir A Ahmad I . Potato diseases in Pakistan. PARC Islamabad. 2000:165.

  • 3.

    Anonymous . Major food and agricultural commodities and producers: countries by commodity. Online. Food and Agriculture Organization of the United Nations, Economic and Social Department, Statistics Division; 2003b.

    • Search Google Scholar
    • Export Citation
  • 4.

    Abada KA . Fungi associated with root rot of pepper and some factors affecting disease incidence. Proc 7th Conf Phytopathol Ghazza; 1994:21926.

    • Search Google Scholar
    • Export Citation
  • 5.

    Siddiqui ZA Akhtar MS . Biocontrol of a chickpea root-rot disease complex with phosphate solubilizing micro-organisms. J Plant Pathol. 2007;89:6777.

    • Search Google Scholar
    • Export Citation
  • 6.

    Groenewald S . Biology, pathogenicity and diversity of Fusarium oxysporum f. sp. cubense. Dissertation, University of Pretoria; 2005.

  • 7.

    Shafique S Shafique S . Tagetes erectus — a tool for the management of Alternaria alternata strains of tomato. In proceeding of International Conference on Applied Life Sciences, 10–13, September, Konya, Turkey; 2012. p. 30914.

    • Search Google Scholar
    • Export Citation
  • 8.

    Shafique S Abdul Majeed R Shafique S . Cymbopogon citrates: a remedy to control selected Alternaria species. J Med Plants Res. 2012;6:187985.

    • Search Google Scholar
    • Export Citation
  • 9.

    Zaheer Z Shafique S Shafique S Mehmood T . Antifungal potential of Parthenium hysterophorus L. plant extracts against Fusarium solani. Sci Res Ess. 2012;7:204954.

    • Search Google Scholar
    • Export Citation
  • 10.

    Amaral JA Ekins A Richards SR Knowles R . Effect of selected monoterpenes on methane oxidation, denitrification, and aerobic metabolism by bacteria in pure culture. App Environ Microbiol. 1998;64:5205.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 11.

    Friedman JS Tepley CA Castleberg PA Roe H . Middle-atmospheric Doppler lidar using an iodine-vapor edge filter. Opt Lett. 1997;22:164850.

  • 12.

    Ayafor JF Tchuendem MHK Nyasse B . Novel bioactive diterpenoids from Aframomum aulacocarpos. J Nat Prod. 1994;57:91723.

  • 13.

    Dahanukar SA Kulkarni RA Rege NN . Pharmacology of medicinal plants and natural products. Ind J Pharmacol. 2000;32:81118.

  • 14.

    Bennick A . Interaction of plant polyphenols with salivary proteins. Crit Rev Oral Biol Med. 2002;13:18496.

  • 15.

    Shafique S Shafique S Ahmed A . ecofriendly response of citrus peels to alternaria leaf spots of tomato: exclusive role of peel phenolics. Int J Agri Biol. 2013;15:123642.

    • Search Google Scholar
    • Export Citation
  • 16.

    Obadoni BO Ochuko PO . Phytochemical studies and comparative efficacy of the crude extracts of some homeostatic plants in Edo and Delta States of Nigeria. Global J Pure Appl Sci. 2001;8:2038.

    • Search Google Scholar
    • Export Citation
  • 17.

    Gruppen H Hamer RJ Voragen AGJ . Water-unextractable cell wall material from wheat flour. 1. Extraction of polymers with alkali. J Cereal Sci. 1992;16:4151.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18.

    Mayer AM Harel E Shaul RB . Assay of catechol oxidase: a critical comparison of methods. Phytochem. 1965;5:7839.

  • 19.

    Burrell MM Rees TA . Metabolism of phenylalanine and tyrosine in rice leaves infected by Pyricularia oryzae. Physiol Plant Pathol. 1974;4:497508.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 20.

    Fu J Huang B . Involvement of antioxidants and lipid peroxidation in the adaptation of two cool-season grasses to localized drought stress. Environ Expt Bot. 2001;45:10514.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 21.

    Eroglu E Melis A . Extra cellular terpenoid hydrocarbon extraction and quantitation from the green microalgae Botryococcus braunii Showa. Biores Technol. 2010;101:2352366.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 22.

    Coker JS Davies E . Selection of candidate housekeeping controls in tomato plants using EST data. Biotechniques. 2003;35:7408.

  • 23.

    Xu WF Shi WM . Expression profiling of the 14-3-3 gene family in response to salt stress and potassium and iron deficiencies in young tomato (Solanum lycopersicum) roots: analysis by real-time RT–PCR. Ann Bot. 2006;98:96574.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 24.

    Kavroulakis N Papadopoulou KK Ntougias S Zervakis GI Ehaliotis C . Cytological and other aspects of pathogenesis-related gene expression in tomato plants grown on a suppressive compost. Ann Bot. 2006;98:55564.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25.

    Van Kan JAL Joosten MHAJ Wagemakers CAM Van den Berg-Velthuis GCM de Wit PJGM . Differential accumulation of mRNAs encoding extracellular and intracellular PR proteins in tomato induced by virulent and avirulent races of Cladosporium fulvum. Plant Mol Biol. 1992;20:51327.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26.

    Danhash N Wagemakers CAM van Kan JAL de Wit PJGM . Molecular characterization of four chitinase cDNAs obtained from Cladosporium fulvum-infected tomato. Plant Mol Biol. 1993;22:101729.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27.

    Rep M Dekker HC Vossen JH de Boer AD Houterman PM Speijer D , Mass spectrometric identification of isoforms of PR proteins in xylem sap of fungus-infected tomato . Plant Physiol. 2002;130:904 17.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 28.

    Tornero P Conejero V Vera P . Primary structure and expression of a pathogen-induced protease (PR-P69) in tomato plants: similarity of functional domains to subtilisin-like endoproteases. Proc Natl Acad Sci USA. 1996;93:63327.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 29.

    Bingham IJ Walters DR Foulkes MJ Paveley ND . Crop traits and the tolerance of wheat and barley to foliar disease. Ann Appl Biol. 2009;154:15973.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30.

    Ya C Gaffney SH Lilley TH Haslam E . Carbohydrate–polyphenol complexation. In: Chemistry and Significance of Condensed Tannins. Hemingway RW Karchesy JJ, editors. New York: Plenum Press; 1988.

    • Search Google Scholar
    • Export Citation
  • 31.

    Fernandez MA Garcia MD Saenz MT . Antibacterial activity of the phenolic acids fraction of Scrophularia frutescens and Scrophularia sumbucifolia. J Ethnopharmacol. 1996;53:1144.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 32.

    The Complete Book of Natural and Medicinal Cures. Wild R, editor. Emmaus, PA: Rodale Press, Inc.; 1994.

  • 33.

    Brantner A Grein E . Antibacterial activity of plant extracts used externally in traditional medicine. J Ethnopharmacol. 1994;44:3540.

  • 34.

    Duke JA . Handbook of Medicinal Herbs. Boca Raton, FL: CRC Press, Inc.; 1985.

  • 35.

    Yen GC Hsieh CL . Antioxidant activity of extracts from Du-zhong (Eucommia ulmoides) toward various lipid peroxidation models in vitro. J Agric Food Chem. 1998;46:39527.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 36.

    Chao GR . Antioxidant properties and polysaccharide composition analysis of ear mushrooms. Master's Thesis. National Chung-Hsing Uni, Taiwan; 2001, p. 548.

    • Search Google Scholar
    • Export Citation
  • 37.

    Gulcin I Buyukokuroglu ME Oktay M Kufrevioglu OI . Antioxidant and analgelsic activities of turpentine of Pinus nigra Arn. Subsp. pallasiana (Lamb) Holmboe. J Ethnopharmacol. 2003;86:518.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 38.

    Sardooei ZA . Induction of resistance to Botrytis cinerea in tomato, bean and cucumber by Serratia plymuthica and plant activators. Ghent Uni Fac Biosci Engineering, Ghent Belgium; 2011.

    • Search Google Scholar
    • Export Citation
  • 39.

    Essghaier B Rouaissi M Boudabous A Jijakli H Sadfi-Zouaoui N . Production and partial characterization of chitinase from a halotolerant Planococcus rifitoensis strain M2-26. World J Microbiol Biotechnol. 2010;26:97784.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 40.

    Osbourn AE . Saponins and plant defence—a soap story. Trends Plant Sci. 1996;1:49.

  • 41.

    Osbourn AE . Antimicrobial phytoprotectants and fungal pathogens: a commentary. Fung Gen Biol. 1999;26:1638.

  • 42.

    Papadopoulou K Melton RE Leggett M Daniels MJ Osbourn AE . Compromised disease resistance in saponins-deficient plants. Proc Nat Acad Sci USA. 1999;96:129238.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 43.

    Bouarab K Melton R Peart J Baulcombe D Osbourn AE . A saponins-detoxifying enzyme mediates suppression of plant defense. Nature. 2002;418:88992.

  • 44.

    Wittstock U Gershenzon J . Costitutive plant toxins and their role in defense against herbivores and pathogens. Curr Opin Plant Biol. 2002;5:18.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 45.

    Ryals JA Neuenschwander UH Willits MG Molina A Steiner HY Hunt MD . Systemic acquired resistance. Plant Cell. 1996;8:180919.

  • 46.

    VanLoon LC . Induced resistance in plants and the role of pathogenesis-related proteins. Eur J Plant Pathol. 1997;103:75365.

  • 47.

    Rasmussen JB . Systemic induction of salicylic acid accumulation in cucumber after inoculation with Pseudomonas syringae. Plant Physiol. 1991;97:13428.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 48.

    Fujioka T Kashiwada Y . Anti-AIDS agents. Betulinic acid and platanic acid as anti-HIV principles from Syzigium claviflorum and the anti-HIV activity of structurally related triterpenoids. J Nat Prod. 1994;57:2437.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 49.

    Kamau DN Doores S Pruitt KM . Enhanced thermal destruction of Listeria monocytogenes and Staphylococcus aureus by the lactoperoxidase system. App Environ Microbiol.1990b;56:27116.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 50.

    McLay JC Kennedy MJ O'Rourke AL Elliot RM Simmonds RS . Inhibition of bacterial foodborne pathogens by the lactoperoxidase system in combination with monolaurin. Int J Food Microbiol. 2002;73:19.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 51.

    Touch V Hayakawa S Yamada S Kaneko S . Effects of a lactoperoxidase–thiocyanate–hydrogen peroxide system on Salmonella enteritidis in animal or vegetable foods. Int J Food Microbiol. 2004;93:17583.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 52.

    Ebbs S Lau I Ahner B Kochian L . Phytochelatin synthesis is not responsible for Cd tolerance in the Zn/Cd hyper accumulator Thlaspi caerulescens (J & C Presl). Planta. 2002;214:63540.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 53.

    Schat H Llugany M Vooijs R Hartley-Whitaker J Bleeker P . The role of phytochelatins in constitutive and adaptative heavy metal tolerances in hyperaccumulator and nonhyperaccumulator metallophytes. J Exper Bot. 2002;53:238192.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 54.

    Küpper H Mijovilovich A Meyer-Klaucke W Kroneck PMH . Tissue- and age-dependent differences in the complexation of cadmium and zinc in the cadmium/zinc hyperaccumulator Thlaspi caerulescens (Ganges ecotype) revealed by X-ray absorption spectroscopy. Plant Physiol. 2004;134:74857.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 55.

    Ueno D Ma JF Iwashita T Zhao FJ McGrath SP . Identification of the form of Cd in the leaves of a superior Cd-accumulating ecotype of Thlaspi caerulescens using 113Cd-NMR. Planta. 2005;221:92836.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 56.

    Bert V Bonnin I Saumitou-Laprade P de Laguerie P Petit D . Do Arabidopsis halleri from nonmetallicolous populations accumulate zinc and cadmium more effectively than those from metallicolous populations? New Phytologist. 2002;155:4757.

    • Crossref
    • Search Google Scholar
    • Export Citation

Monthly Content Usage

Abstract Views Full Text Views PDF Downloads
May 2020 0 9 4
Jun 2020 0 8 5
Jul 2020 0 22 8
Aug 2020 0 12 1
Sep 2020 0 26 10
Oct 2020 0 12 6
Nov 2020 0 0 0